,Photoshop 3.08BIMyShttp://ns.adobe.com/xap/1.0/ image/jpeg Graphe 6 2014-10-07T10:57:30+02:00 2014-10-07T08:57:31Z 2014-10-07T10:57:30+02:00 Adobe Illustrator CS5 256 208 JPEG /9j/4AAQSkZJRgABAgEAlgCWAAD/7QAsUGhvdG9zaG9wIDMuMAA4QklNA+0AAAAAABAAlgAAAAEA AQCWAAAAAQAB/+4ADkFkb2JlAGTAAAAAAf/bAIQABgQEBAUEBgUFBgkGBQYJCwgGBggLDAoKCwoK DBAMDAwMDAwQDA4PEA8ODBMTFBQTExwbGxscHx8fHx8fHx8fHwEHBwcNDA0YEBAYGhURFRofHx8f Hx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8f/8AAEQgA0AEAAwER AAIRAQMRAf/EAaIAAAAHAQEBAQEAAAAAAAAAAAQFAwIGAQAHCAkKCwEAAgIDAQEBAQEAAAAAAAAA AQACAwQFBgcICQoLEAACAQMDAgQCBgcDBAIGAnMBAgMRBAAFIRIxQVEGE2EicYEUMpGhBxWxQiPB UtHhMxZi8CRygvElQzRTkqKyY3PCNUQnk6OzNhdUZHTD0uIIJoMJChgZhJRFRqS0VtNVKBry4/PE 1OT0ZXWFlaW1xdXl9WZ2hpamtsbW5vY3R1dnd4eXp7fH1+f3OEhYaHiImKi4yNjo+Ck5SVlpeYmZ qbnJ2en5KjpKWmp6ipqqusra6voRAAICAQIDBQUEBQYECAMDbQEAAhEDBCESMUEFURNhIgZxgZEy obHwFMHR4SNCFVJicvEzJDRDghaSUyWiY7LCB3PSNeJEgxdUkwgJChgZJjZFGidkdFU38qOzwygp 0+PzhJSktMTU5PRldYWVpbXF1eX1RlZmdoaWprbG1ub2R1dnd4eXp7fH1+f3OEhYaHiImKi4yNjo +DlJWWl5iZmpucnZ6fkqOkpaanqKmqq6ytrq+v/aAAwDAQACEQMRAD8An3mvyR58mg8xQWcF9e2d xrst3YW/1+kjRSaL6NvKkssyskcGolG48vh41C0UYVSO6/K/83b3UL+6F3cW9/aTm7N010Hi1G4j nlayMSeoojWGB0H7xRSlOJw2r1P8sk862PlGS382IRfWEjQ2Rdo2d7aGGNVZ2jZ+VZA9GY8itCd8 BVmmBWL3Pm68ivJ7dLZGWGR4wxY1IViK/hmOcxunFOoNkU0PNmon/j1j/wCCbHxT3L48u5pvN2oK N7WP/gmx8Y9yPzB7kz8v61NqizmWJYjCVACkmvKvj8ssxz4m3FkMrTfLG5B63fvp2jX+oIgkeztp bhUOwYxIXANPGmRnKokteWfDAy7hbzG3/OPXpwCulQb/AOW/9M1/52Xc62HaM5fw/aif+VreYqV/ RVv/AMG+H85LubPzs/5o+ahP+cGvwgltKt9v8t/6YPzsu5hLtCY/h+1n/k7Xpte8uWmrTRLBJc+p yiQkgenK0exP+pmdhnxRBc7TZvEgJVV/rTnLG9j3nrzPceXNFXULeBbiRp0h9NyVFHDGtR/q5Rny mEbDj6rOcUOIC2FRfm75gkFRpVv/AMG/9Mxfzsu5w46+Z/h+1VP5reYgK/oq3/4N8fzku5l+dn/N HzQlz+dGuW4JfSoKD/ix/wCmD87Luap9pTj/AA/a9czZO3dirB/Pf5gX/lzVbaxtbOO5E8PrF5GZ SDzK02+WYmo1BgaAcHVas4pAAXaSR/m15hcVGlW//BvlP5yXc1DXTP8AD9rb/mx5iUVOlW//AAb4 /nJdynWz/mj5ozyt+aGqax5ls9IuNPhgjufUrKjsSPTiaTYH/UyzDqjKQBCcOulPIIGNW9GzNdk7 FXYq7FXYq7FXYq7FXYqo3v8AvHP/AMY3/wCInFVbFWCPEH1W9/5iJf8AiZzEPMuBXqPvTGO0Xj0y YDaIqN3agKdsBDGUUZ5NFPro/wApP1NksPVnp+rJMvclKfN//KJ63/zAXX/Jlsry/QfcWjU/3Uv6 p+5475csVkhTbtmpxxt1unhsyhdHThXjl/A5fAkGvaescTmnY5VkjTj5obPRPysFPImmj3uP+omX Nhpf7sOV2f8A3I+P3lleZDmMI/N1eXliAeN5F/xB8xNZ9HxcLXj0fEMP0fTVeNdsw4RaMcNk3l0d BHXjlhg3GDC/NNmIoXIFNjmPMU6/Vx9JfQmbt3zsVeUfmrEJPNmng/8ALIP+Tr5rdZ9Y9zq9aLyD 3KenaUjRj4chGDOEFa80lFjJ44ZQZSglflCARfmHpNPG4/6hpcGnH7wOLijWePx+4vac2ruXYq7F XYq7FXYq7FWE/mt561fyZokOqWGnLewK0hvJZBMY41jjZ0jPopIytPIFiR2HEMRywhWFat+fev6f dTf7gUmtEuWb900jyw2NveXdnO1woWiSF7EshrwAah3G7SvQPJfnez84+UpNUgie3mjUwX0DjZLj 0ElYIf2kpKpU+HUA7YCrK8VYXGtdUvf+YiX/AImcxepcIfUfenUSDjlobwhr5BwORkxk35R+3ff6 yfqbDh6o0/VkWXOSlPm//lE9a/5gLr/ky2V5foPuLTqf7qX9U/c8y8oxAwp8hmtwhwdONmaLCvp5 l05lMX80xAQP8jmNlDj5hsy38rv+UG07/Wuf+oqXMzS/3YbNB/dD4/eWVZkOYwv82BXy5b/8xsX/ ABB8xNZ9A97h636B70m8vwgwr8soxBjiGyezQr6Zy4huIeeedowLeT5HMPK67WD0l7nm4dy7FXl3 5lLXzfYf8wg/5Ovmu1f1j3Ot1X94Pcmekwj0l+WSgG+ARF/CvpH5ZKQZSDFvLqgfmJpP+tcf9Q0u UYf70fjo4cf76Px+4vX82jtXYq7FXYq7FXYq7FUNe6bp18bc3trFc/VJlubX1kWT054wQkqcgeLr yNGG4xVDReWfLkTX7RaXaIdUYSakRBGPrDAkgzbfHuxPxdyT1JxV0Gj6TpWmXcGmWcFjDL6s0kdv GsStK4+JyFAqxp1xVMsVYbD/AMdS9/5iJf8AiZzF6lwx9R96dx/ZGXBvCGvfsHIyYSW+Uvt33+sn 6mxw9VwdWRZc5CU+b/8AlE9a/wCYC6/5MtleX6D7i06n+7l/VP3PN/J4/cR/IZrsLh6bkzQfZzLc ti/mof6O/wAjmNmcfNyZR+V3/KDad/rXP/UVLmXpf7sM9B/dD4/eWVZkOYwz81v+Udtv+Y2L/iD5 iaz6B73E1v0D3pZ5eH7hfllWJGLkncn2DlxbS8888j/R5fkcwszrtZ9Je3Zt3cOxV5h+Y/8AymFh /wAwY/5Ovmu1f1j3Ou1X96PcnGlD9yPllkHIgrXv9ycMkyYpoH/kxNJ/1rj/AKhpcow/3o/HRwo/ 30fj9xeuZs3auxV2KuxV2KuxV2KpV5h81eXvLlvFca3fxWMM7+nE8pPxMFLNsATRVUszdFG5xVAS fmP5Fju5bR9atluYbqOwliLbi5lLKqdN/ijcFhsCrAkUONKnBvLW90j65aSrNa3Nv61vMhqrxyJy RlPgQa4qjMVYbD/x1L3/AJiJf+JnMXqXDH1H3p3H9kZcG8Ie9+wcjJjJb5S+3ff6yfqbHD1Rg6sh y5yEp83/APKJ61/zAXX/ACZbK8v0H3Fp1P8Ady/qn7nlega1pOmx2Md/dx20l9ILe0WRgpkkIrxX 6BmvwAlw9MNmRaf588nX+h3GuWmrW8uk2r+lPecqIslFIT4gCWPNaAdSaDfMzhPJzKSTzF5l0C5u 7jS4L6GXUIGMctsrVcMFLEU9gpqfEEdRTMbNE1bj5hszn8rv+UG07/Wuf+oqXMnS/wB2GWg/uh8f vLKsyHMYZ+a3/KO23/MbF/xB8xNZ9A97ia36B70t8vf3C/LKsSMfJOpPsHLi2vPPPP8AvNL8jmFm ddrPpL27Nu7h2KvMfzH/AOUwsP8AmDH/ACdfNdqvrHuddqf70e5N9L/uR8ssg5EOSvef3JwySWKa D/5MTSf9a4/6hpcow/3o/HRw4/30fj9xet5s3aOxV2KuxV2KuxV2KsK/NL8u5fPGmWVil9HZrazS TH1oDOpaSB4FcBJIG5R+qWClijdHVhhBVjV7/wA4/wBjqX1/9J6q0xYy/odo4jEbb17u5vHaXjJ+ +bnesq/ZWig0JxtWU+RPI8vk3yvfaU9+dQWSaWeFyhjEcZiSNYwpeT/fXNjt8THbEqzHArDYf+Op e/8AMRL/AMTOYvUuGPqPvTtPsjLg3hD3v2DkZMZLfKX277/Wj/U2OHqjB1ZDlzkJT5v/AOUT1r/m Auv+TLZXl+g+4tOp/u5f1T9zwZ/y7bzHqui6wmpvbTaTJFJHbPGs0DBCzNsDHIpclQxD7hR3oRh6 bJQpxdNKo0iIfyc8yjTTobazbppEFwmo2ESwzmKCcpJB6EKNcmVIokIlX95vIQRSh5ZfGObl2lvn H8mbUalHq1nqcsV2ixG4kkDSNLIvP1pCeYo0jMJB4PU7g0FU89Dk05J0Ht/5Xf8AKDad/rXP/UVL ktL/AHYRoP7ofH7yyrMhzGGfmt/yjtt/zGxf8QfMTWfQPe4mt+ge9LfL39wvyyrEjHyTqT7By4tr zzzz/vNL8jmFmddrPpL27Nu7h2KvMfzH/wCUxsP+YMf8nXzXar6x7nXan+9HuTfS/wC5HyyyDkQ5 K95/cnDJMmKaD/5MTSf9a4/6hpcow/3o/HRw4/30fj9xZZ+Ymo+c7KCxPliF5pHaQXQSITUUBeNa g075laiUxXC36yeWIHhiy8+/NDVfzTh8w6IdDbUkVtMtZJobOCWRJLt7oLcoVSJ4uYhYk+oyhV+I HlQHIx/SL5uXAmhfNJvIutfmZLPoMXmO515NCe5V766jtrl5frDWNu0Vu7G3+s+kblpvU+D0waKH IGTZPoC6kvlkAgQMlNzxDGtfeSKn45FVH1tW/wB9f8k0/wCyjFVCOe8N3MOT/WAqfuOAMe/Lc/vH Cn/ZL9OKsP8AzA1Xz3B5l8utounXk2nacVvde+p/HFIs0iwGH4jE03pxetJxjRm5CMlRWuKvRsVd iqje/wC8c/8Axjf/AIicVVsVYbD/AMdS9/5iJf8AiZzF6lwx9R96dp9kZcG8Ie9+wcjJjJb5S+3f f60f6mxw9UYOrIcuchKfN/8Ayietf8wF1/yZbK8v0H3Fp1P93L+qfuec+Tv7iP5DNdhcPT8mZDpm W5bGPNX9w/yOY2Zx83Jk/wCV3/KDad/rXP8A1FS5l6X+7DPQf3Q+P3llWZDmMM/Nb/lHbb/mNi/4 g+Yms+ge9xNb9A96W+Xv7hfllWJGPknUn2DlxbXnnnn/AHml+RzCzOu1n0l7dm3dw7FXmP5j/wDK Y2H/ADBj/k6+a7VfWPc67U/3o9yb6X/cj5ZZByIcle8/uThkmTFNB/8AJiaT/rXH/UNLlGH+9H46 OHH++j8fuLOfzBPnAeVLs+T15+YOUP1RawLt6yervcAxU9PlWvbpvTNm7RiMGr/naW1T6vYWdw9s xhs4p5LZwWN6DWb0Joirixk5cajoO5piqMTUvztmktkl0rT7WL1l+tSRFZH9FUhZinO4oCz+qtCD tTcfbKr0TFXYq7FXYqwv81LbXbnRbG20K61C01S7v7e1hn08kLEszUlnuaI/7qGIO/YcqDvhCvNt Rm/OyS81WTR5tQK6beNc3UFxG6o/o3l4lvb2dY+U0clots7qpKmtWarGpV6N+XGt+adW8l3DeZbO S01KyZ7MvLG8TzrFAnKYq4XcyM6kr8JKkjbbAVZvgVhavw1C/ehbjPMeKipNHOwHjmMOZcMfUfe8 aT889fu/I91q/wClLTStaj1K3hs7WaGI2ki3UaSJaNO8u3oJVrhzxZTtQbZkcLk0mXlP82/Osvmy 28uebNNCS3bNbpJCqqVuFQXEmwLh0SOaMDidkIdq94ziKYTGz2byl9u+/wBaP9TZDD1Y4OrIcuch KfN//KJ61/zAXX/Jlsry/QfcWnU/3cv6p+55x5P/ALiP5DNdhcPTcmZjpmW5bGPNX+87/I5jZnHz cmT/AJXf8oNp3+tc/wDUVLmXpf7sM9B/dD4/eWVZkOYwz81v+Udtv+Y2L/iD5iaz6B73E1v0D3pb 5e/uF+WVYkY+SdSfYOXFteeeef8AeaX5HMLM67WfSXt2bd3DsVeY/mP/AMpjYf8AMGP+Tr5rtV9Y 9zrtT/ej3Jvpf9yPllkHIhyV7z+5OGSZMU0H/wAmJpP+tcf9Q0uUYf70fjo4cf76Px+4s1uvzK8l 2t2bSe/ZLhTJVPq9yRSGVoZGDCMqVR42q1aAAt9nfNm7R5xr4/JfXtXuL258w6gkutyRThLaGVYX KWk1tVWFo3JY41l9Xmx9NlIfiKriqP8ALWtflHoevR6tpmsXt7qOotNpdtBJFLxcy3jTSeivoQrx WXkOSnieJHxMMVZxon5k+TtavrOwsb1jf3yTSWttLBPEzrbECVlMiKrKpNOQNGoeJNDirJsVdirs VdirsVUb3/eOf/jG/wDxE4qrYqw2H/jqXv8AzES/8TOYvUuGPqPvTYWts6APEjCpahUEVPU/PLg3 hSvUTiW4jl4038MjJjJ3lL7d9/rR/qbHD1Rg6shy5yEp83/8onrX/MBdf8mWyvL9B9xadT/dy/qn 7nm/k8/uI/kM12FwtPyZoD8IzLcxi/mo/wCjv8jmNmcfNyZR+V3/ACg2nf61z/1FS5l6X+7DPQf3 Q+P3llWZDmMM/Nev+HbanX67F/xB8xNZ9I97ia36B73jNh+b2s6Vos1xe2FpJN+kJbC2mt3ne39O zhM15cufTMjJCFIoq1JByUMQ6MoReiL5q1SbzgNKtora90ibTzfieBnE8C/CIjNyHpn13LiNV3op JwmOzMjZ5Gv5qy6/MdN1TTm06/kXiEAaizcZJWjcPxZaRKtNtzXptlGpwULDg62HoJfWOZ7tHYq8 x/Mf/lMbD/mDH/J1812q+se512p/vR7k30v+5HyyyDkQ5K95/cnDJMmKaD/5MTSf9a4/6hpcow/3 o/HRw4/30fj9xekN5Y8tNcNctpNkbhxIHmNvEXYTFmkq3Gp5l2LeNTXrmzdopxeTfKEUnqxaHp8c nHhzW1hDceBi41C9PTJWnht0xVseUPKYkhkGiWAktwwt3+qw8ow5Zn4Hj8PIuxNOtT44qvsfK3lj T51uLDSLK0nRpHSWC3iidWmAEjBkUEF6fEe/fFUzxV2KuxVjXnjz5pHlC2sZb8F5dRuBbW0YZI1G xeSWWSQqkcUaLVmPt440rD9W/wCcgtC0u8aG60y4W3a8+r210HjKy28dxcWs9wADyX05bKSkZ3Yc TtU0NKzXy75u0jzX5YbVtLk5RvEVnibZ4ZjEsjRP/lKHG42PUbYFZBirDYf+Ope/8xEv/EzmL1Lh j6j707T7Iy4N4Q979g5GTGS3yl9u+/1o/wBTY4eqMHVkOXOQlPm//lE9a/5gLr/ky2V5foPuLRqf 7qX9U/c8u8pzhYU37ZrMRcHTnZma3a+n1zK4nMti/me4DQPv2OY+UuPmOzMvyt/5QXTv9a5/6iZc zdL/AHYbdB/cj4/eWVZkOYwz81v+Udtv+Y2L/iD5iaz6B73E1v0D3sX0nyl5XvNIh0670m0nsIXM 0VpJBG0SyMSWdUIoCSxqffK8cjztcZKY6P5D8o6I8Nzp2l28V9BF6K3/AKam4ZaUYtLTkS37R75d KRLaSw/zvoukLLJfrZQLegu4uRGok5SKFduVK1ZVAOYWaZqr2ddrCeAves2zt3Yq8x/Mf/lMbD/m DH/J1812q+se512p/vR7k30v+5HyyyDkQ5K95/cnDJMmKaD/AOTE0n/WuP8AqGlyjD/ej8dHDj/f R+P3F63mzdo7FXYq7FXYq7FXYqkvmjyb5e8zwQQ6zbtMluZPTMcssDcZo2hmjLRMjFJY3KupNCMV QUX5Z+SIzqdNMVhq9ReK8krDi0kkzJFVv3KNLPI5WPiCWOG1Rej+VNC8taNe2WjW5tredpbmVC7y VkZAnWRmIARFUAbADAqeYqw2H/jqXv8AzES/8TOYvUuGPqPvTtPsjLg3hD3v2DkZMZLfKX277/Wj /U2OHqjB1ZDlzkJT5v8A+US1v/mAuv8Aky2V5foPuLRqf7qX9U/c8L0XWUgjUFqUGaeMqdNgzABP h5ni405jLPFcr8wEo1fXI5o2AatRlcp20Zc4p6v+VRr5C0w+JuD/ANPMubTS/wB2HYdn/wByPj95 ZZmQ5rDPzW/5R22/5jYv+IPmJrPoHvcTW/QPelvl7+4X5ZViRj5J1J9g5cW15555/wB5pfkcwszr tZ9Je3Zt3cOxV5j+Y/8AymNh/wAwY/5Ovmu1X1j3Ou1P96Pcwlvz00nT59bsv0XczXGjUAQPGpkA uktHZqn90A0gdeX2k+LbMmGLYOVCOyY+Zfzn0TRzpsN9aSL+krC3vxJHLFLGn1pyirzjZlkVRG5Z 0JH2aV5bHwyUkJj5TvrS/wDPGh3tnKJrW4E0kMq9GVrWQg775iYhWUD8cnBH99H4/cXsWbJ2jsVd irsVdirsVdiqheX9jYxCW9uYrWJmCLJM6xqWO4UFiBXbFVM6vpQkeM3sAkjlS3kQypyWaShSIiuz tX4V6nFVS6dHsJnRgyNEzKymoIK1BBGKq+KsNh/46l7/AMxEv/EzmL1Lhj6j707j+yMuDeEPe/YO Rkxkt8pfbvv9ZP1Njh6owdWQ5c5CC1yNJNF1CN1DI9tMrKdwQYyCDkZ/SWvKLifc8wt/KujSAH6l F/wIzAGKPc6uOnh3BFf4N0en+8cX/AjJeDHuZ/lodwULjyno6An6lF/wIwHFHuYy00O4M/8AJtvD b+W7SGFBHEnq8UUUArK5O3zzLwioh2GmiBAAJ1lrewz81v8AlHbb/mNi/wCIPmJrPoHvcTW/QPel vl7+4X5ZViRj5J1J9g5cW15555/3ml+RzCzOu1n0l7dm3dw7FXmP5j/8pjYf8wY/5Ovmu1X1j3Ou 1P8Aej3IWLyH5bvl1CeWKdLrVQi3t1DdXEUzRxjiIhIkissVCaxrRT4ZdCZpyYHZEat5B8o3WiWe lS6bH9Q06Iw2UKll9NDE0NAykN9lyak15fF9oA5IzISSlfk/TrPTfOuhWFlH6VrbCaOFKliFW2l6 sxJJ8SdzmNjN5QT+NnCB/fR+P3F7Jmydo7FXYq7FXYq7FXYqwb82fJ2r+aNK0+HSIbZ9RsroXNpc 3coWKCT02jEjwNb3SXCUc8ozx9jhCsG1H8g9d1O51O4nvre0uEnluNMuLdn5XM8l7eXST3ZMdUMS XwjXjyb4T8QGNqz38u/LXmXy35OudK168S8eB5F08xu0ix2iQJHHHV1Qj4kZgvRQadsSrNcCsMh/ 46l7/wAxEv8AxM5i9S4Y+o+9O4/sjLQ3BD3p+A4JMZLfKX277/WT9TY4eq4OrIsuchCav/xyb3/j BL/xA5GfIsMn0n3MS0uIFBmNEOJAJuLccemWU3Ul2pQgI2QkGuYT3yt/xwrb5yf8nWy7F9Ldg+gJ rljcwz81v+Udtv8AmNi/4g+Yms+ge9xNb9A96W+Xv7hfllWJGPknUn2DlxbXnnnn/eaX5HMLM67W fSXt2bd3DsVeY/mP/wApjYf8wY/5Ovmu1X1j3Ou1P96Pcm+l/wByPllkHIhyV7z+5OGSZMU0H/yY mk/61x/1DS5Rh/vR+Ojhx/vo/H7i9bzZu0dirsVUpbq3ibjJIENKktsAD0qegrTauKqiSJIgdGDo ejKag/SMVbxV2KuxV2KqN7/vHP8A8Y3/AOInFVbFWEo9NUvf+YiX/iZzF6lwh9R96cxTDjlgLcCh 72UFDgkWMiu8oGrX3+sn6mw4eq6fqyPLnJQmr/8AHJvf+MEv/EDkZ8iwyfSfcxnRx+7XKIONjToD 4ctb0r1Ufu2+WVzappt5W/44Vv8AOT/k62WYvpbcH0BNcsbWGfmt/wAo7bf8xsX/ABB8xNZ9A97i a36B70t8vf3C/LKsSMfJOpPsHLi2vPPPP+80vyOYWZ12s+kvbs27uHYq8x/Mf/lMbD/mDH/J1812 q+se512p/vR7k30v+5HyyyDkQ5K95/cnDJMmKaD/AOTE0n/WuP8AqGlyjD/ej8dHDj/fR+P3F6L5 g1a909IWtYBOZCwYEMaUpT7PzzPyTI5OdlyGPIPNvzo/MHzj5VbTLrR7qOGK70u+u5bWSBJB61mI Sp5N8VG+s7j/ACcsjuG2JsMbt/za/NjUvPGuafp9tFHZ6H6811ZzJBSK3illjczSrIWaRFQcPSJD N1+HJUl6Z+VGuTea/Ium65qVzHeajcxq1xNCYFMTsoZogbV348eX2WIcdGUHAVZPIDZXMLKSYp3E bV3bk2y79W8anwPWooFTDFXYqwH869R8+WXkm4Pku0uJtSc/vrm0VJJ4IkBascTMGdncKnwqxClj SoGEKwHU7n87Z77Vp9IkvwNPvWuru2niZI2MV7eJBbWX7ussUlqtszqhKnqW3NSr0X8uNb806t5L uG8y2clpqVkz2ZeWN4nnWKBOUxVwu5kZ1JX4SVJG22AqzfArz26uRFq17U0/0iX/AImcwydy64yq R96ITVowPtYeJn4ilPqaMtK4DJiZpx5Jfmt63+Un6my3B1btMebJ8vcpCav/AMcm9/4wS/8AEDkZ 8iwyfSfcxvR/7tcog4+NOR0y1uSzVf7tvllcmqaaeV/+OHb/ADk/5OtlmL6W3B9ATXLG1hn5rf8A KO23/MbF/wAQfMTWfQPe4mt+ge9LfL39wvyyrEjHyTqT7By4trzzzz/vPL8jmFmddrPpL27Nu7h2 KvMfzH/5TGw/5gx/ydfNdqvrHuddqf70e5N9L/uR8ssg5EOSvef3JwyTJimg/wDkxNJ/1rj/AKhp cow/3o/HRw4/30fj9xeg+bvMbeXdIGqG3FzBHPDHdLzKMkMsgR5EASTmyBqhNq/zDNm7RiejfnLp ms2Wpy2+jXgvdMeJHsJTCskiXF19WUIS9Ofdlaig7ciPixVBz/8AOQXkuK1urq2sb2YW1wkEwCQo zqVDyyxj1OTiMMARSvJlXvXFXoXl/UrLU9GtNRsoWt7W7jEscTqqMA38yqWWvyOKt6v/AMeX/MVF /HFUfirsVdirsVUb3/eOf/jG/wDxE4qrYq82vYGl1e++I0+sS9/8s5x+XiOWe5+o9fNr4QqrpZI6 n7zlowy7z814QpzacUB3P3nITxyHU/NeEJ95EBVb4Ek0aPr8mzZdik1OzfJlEUyrN4yQmr/8cm9/ 4wS/8QORnyLDJ9J9zzLU/wAwdL8u6voOjSwyXV9rlylvFHCV/dK9VWSQsRQMwoo70b+U5VjjYaMQ 2bl/N2EeS9V80R6NOkWi381hf2V1LDDMhtyA7bGRC3JgoQHr3pvlvC3Uk91+eXlaXzJLoFzFLZSL IYkuJipQgBgSQheh9RKeHGj1pWkJYzTXOOz1ryv/AMcO3+cn/J1sOL6WeD6AmuWNrDPzX/5R22/5 jYv+IPmJrPoHvcTW/QPelfl4/uV+WU4mOLknkp+A5eW4vO/PJ/0eX5HMLM67WfSXt+bd3DsVeY/m P/ymNh/zBj/k6+a7VfWPc67U/wB6Pcm+l/3I+WWQciHJXvP7k4ZJkxTQf/JiaT/rXH/UNLlGH+9H 46OHH++j8fuLKPNvmDz5BrMum+VdNtr54rKG5ZrkhVDzXLR05GeHpHGzBQu/dloFfZu0S2LUPzuS 7njbTtPkhlt1mhnZUCRXItkLQBFuldkM6stWP7VeXEUxVQn1z8+oru1hi8vaZcwlYmu7r1BCvJ3j MiopupHHCNpFrRqsAw2PHFWU+U77zvc3WoDzJYQWVrGIP0a8JX1JOSEzGVVmuApVqDiDt/M3XFU0 1f8A48v+YqL+OKo/FXYqxj8wPOy+TtHi1aWyN5atOkE4WaOF1EhoCgk2dq/s1HzAwhWI6v8A85A6 HpV40N3pdykBvDbW91zj4yQR3Fxaz3HEfEvpy2UlIzuw4napo0rNfLvm7SPNflhtW0uTlG8RWeJt nhmMSyNE/wDlKHG42PUbYFZBirAwgbVr7/mJl/5OHOWEbyz/AK0vvYpxDbjj0zZQhslD30ACHbKc 0NkK3ksUa/8A9aP9TZPsf+P4fpSGTZukoTV/+OTe/wDGCX/iByM+RYZPpPuef/4J8razqWn6vqOn RTappssU1ne0Kyo0DM0Y5qQWVWcnidq9spgTTj4zsvn/ACp8tTz6nymvorDVmkmvNOt726t4XnuX d7qRxFKnL1wyqyn4QF2G+W232oeaPy38l6lJFcXWmr6tusKQmN3iAS3VkRaRsoI4OUb+ZaA7AZCU yGqcizryv/xw7f5yf8nWyWL6WzB9ATXLG1hf5smnlu3P/L7F/wAQfMTWfR8XD1v0D3pFoFwBEu/b MfGWGI7J5NdL6R3y4luJefedJQ0EnyOYeUuu1h9Je7ZuXdOxV5j+Y/8AymNh/wAwY/5Ovmu1X1j3 Ou1P96Pcm+l/3I+WWQciHJXvP7k4ZJkxTQf/ACYmk/61x/1DS5Rh/vR+Ojhx/vo/H7iyjz55B1fz NeWtzYeZLrQmtYJ4UFspJ5zrx9VWWSJgyrt/Q5s3aMc1X8s/PYZY7Tzhqly17cSq9xzZEtIZgS0h T61GrlQqrGojYA/srXmqq8/lP5m0+KwtdH8zXUMKwT2VxInqxlPWguOF0VFwqu0U0qlUp77GrYqz LyZ5Y1XQLW6h1HXLnXXuJjLFNd8uUSHpGvJ5Nh7UxVM9XRjBE6irRSh1H+XQiMfS5UYqjUdXRXQ1 VgCpHcHcYq3iqTeaPKWjeZ7JbHVxPJZBqy20NzPbxzKesc6wvGJUP8r1GKoGP8tPJKNqZ/Rof9L8 vroeSVhxeWSZ0iq59FGlnkdlj4gljhtUXo/lTQvLWjXtlo1uba3naW5lQu8lZGQJ1kZiAERVAGwA wKnmKsIiH+5a9/5iZv8Ak4c5nH/ez/rS+9insQ+AZtY8koa/HwHKc42Vb5O+3f8A+tH+psj2Tzn8 P0qGS5uUoTV/+OTe/wDGCX/iByM+RYZPpPuY3o/92uUQcfGnI6Za3JZqv923yyuTVNNPK/8Axw7f 5yf8nWyzF9Lbg+gJrljawf8AOBuPlaFvC8i/4i+Ymt+j4uD2gax/EMD0vV0jjUcswYzpxceXZMpN eQpTlkzkbTlYr5jv1micA9cpkbcHVZLi+jM3j0LsVeY/mP8A8pjYf8wY/wCTr5rtV9Y9zrtT/ej3 Jvpf9yPllkHIhyV7z+5OGSZMU0H/AMmJpP8ArXH/AFDS5Rh/vR+Ojhx/vo/H7i9bzZu0dirsVdiq 2WJZYyjdD3HUEbgj3BxVLEv5becwrC1xGeTVh33rvxrTqx33ov8AN0GKsU8//mFq3l3V9LtbaCNY LiznvrtZ4Jp2Ahnt4vTaWBxFaqBcMzzy8o14074qzi81HT7L0vrl1Fbeu4jh9aRY+bnoq8iKsfAY qsOr6UJHjN7AJI5Ut5EMqclmkoUiIrs7V+FepxVUunR7CZ0YMjRMyspqCCtQQRiqvirCYP8Ajq33 /MTN/wAnDnNY/wC9n/Wl97FPYvsDNrHklDX/APdnKc/JVvk77d//AK0f6myHZPOfw/SoZJm5ShNX /wCOTe/8YJf+IHIz5Fhk+k+5jOjn92uUQcbGnQPw5a3pXqh/dt8srm1TTbyt/wAcK3+cn/J1ssxf S24PoCa5Y2sV/MjS4NT8vJbTM6L9YRwYyAahW8Q3jmPqY8UXE1uMThR73nUXkG1I+G5uQP8AWT/m jMP8uHWjRjvKqfIMFP8Aeq5/4JP+aMfy4T+U8yhLjyHYAH1Li4P+yT/mjAcAa5aMdSXuubV6B2Kv MfzH/wCUxsP+YMf8nXzXar6x7nXan+9HuTfS/wC5HyyyDkQ5K95/cnDJMmKaD/5MTSf9a4/6hpco w/3o/HRw4/30fj9xet5s3aOxV2KuxVC6lMIrY9fiNDx68QCz0PjwVqYqqW0HpRjkB6rAeoV6VA6L /kr0GKofUdB0LU5refUtOtb2azYvaS3MMcrRMaVaNnVih2HTFWL/AJseV9X8zeXodK07T7O+WW4j N8byY27pbKQ0i28ohuOEkvHgW47KT3pQhWCal+QeuapdanczXtvZXCzy3GlzW7uXuJpL28ukmu2M QKtEl8I148m+E/EBjas8/Lvy15l8t+TrnStevEvHgeRdPMbtIsdokCRxx1dUI+JGYL0UGnbEqzXA rB0YLqWoMa0FxMTxBY7O3QAGuc1j/vZ/15fexeI6nr35sR+V7pdJl1uSKPWJzpt/JbXDSyWgsi8K MGt47k/6T8PxRCNn+EsE3zfxEfJKdeUNa/OXT/NNnpnmW0nvtPui1vPcujFYnEYuJJRKihAKzADk abGNN1oKNTGBgSFe0eTvt3/+tH+psw+yec/h+lQyTNylCav/AMcm9/5h5f8AiByM+RYZPpPuYlpc wVBmNEuJApsLkceuWW3cSXajOChyEi1zKfeVf+OFbfOT/k62XYvpbsH0BNcsbkk83iulxj/i5P1N lWbk0aj6Ums4AVG2VANMQi2thx6ZKmdJNqkQVDlcg05A9CzMdg7FXmH5j/8AKYWH/MGP+Tr5rtX9 Y9zrtT/ej3JxpX9yPllkHIgrXv8AcnDJMmKaB/5MTSf9a4/6hpcow/3o/HRw4/30fj9xem6hr+ha a/DUdStbJxGZitxNHEfSDBC9HZfh5sFr0qaZs3aPMNWsNGv9e1rV9I/MmDSTcyQTXEatEI0SO0KJ xkE0Jkif6wkhbkVrsCCNlU08mpoejalBezfmBbarBcWjW6WZuoxFNcy3XJ7pQbiUF2kf0th4CtSa qs+0/WtG1JpE06/t7xoVRplt5UlKLKC0ZYITQOBVa9cVWav0sx2N1GD8jUHFUfirsVdirsVUb3/e Of8A4xv/AMROKq2KsJg/46t9/wAxM3/Jw5zWP+9n/Wl97FPY/sDNrHklDX/92cpz8lW+Tvt3/wDr R/qbIdk85/D9KhkmblKE1j/jkX3/ADDy/wDEDkMhAiSe5hk+k+551BfiMAVzWjVYv50fmHAAkOhR H6XFOuH83i/nR+YZ3LuKjNqIcEVwHV4v50fmGJ4u4s48pmugWp8fU/5OtmfgkJQBBsOZgFQCbZc2 pJ5u/wCOZH/xmX9TZVm5NGo+l43q3lTzM9556eKzu9Vs9TsLI6NatfPGr3kbysVQiaNoUjdlYqCo I23rjEjZECKCHttB89SXeiabpP12PRtItX0l9QuJAF+tj1re/wBQp66yswqPq/IHflQKDXJ2GZIQ Pkvy5+Znl7X5bPVXNzoEiSATM6OqLE8oiRKu0ijdSi0+w3xUIoK8piR5tGYgh9K5c5jsVeX/AJlN TzfYf8wY/wCTr5rtX9Y9zrtV/eD3JnpMw9Jflk4FvgURfyr6R37YZFMixXy61fzE0n/WuP8AqGly jD/ej8dHDj/fR+P3FX/Nm0uV8ww3X+FLrzVZT6fwltoGuERZLWV5ogGgLASNI60Zk+FeXE/EwzaO 1SG9vrS1nmv3/LO9SVFk06EyXN5ylT0vqsEcaLG0RaWMFalgAKUcsQMVQdxp+nCTT7vXfy6luNQk s3aJIpdRjHq2cMk8NqkZEqNJItnGAK1/1jVcVelflhBAU1a+/wAM3Plu7uJ1juPrc008lyIFKpMW mAJqP2hXl1JrirKdX/48v+YqL+OKo/FXYqxH80/MOu+XfKTavo8kCTQXdnHOtxG0vKG4uo7dglHQ K370GprtXbuCFeZar+bP5lxX2qtpcUF9a6XePLqVukKhrK2gvry1+rSOW3aeO0jkrTn8R4ihFDSv Rfy587z+cPJk9/dW/wBXvbQtZXvEgo86W8cjugH2QTLQqfskEVNK4CrNsCsIhP8AuVvv+Ymb/k4c 5rH/AHs/60vvYp9EfgGbWPJKFvz8BynPyVryd9u//wBaP9TZDsnnP4fpUMkzcpQetf8AHHv/APmH l/4gcxtZ/cz/AKsvuQXnlpaq6gkZyWHECGKMGnpTpmT+XCoa6s1VTtlGXCArNPKH/KPWv/PT/k62 dH2T/i8fj/uiyCcZsUpH5vNNLQ/8XJ+psqzcmjUfSktpcqFG+UgtMZIprtePXJWy4kn1OYMpocrk WnIXomZrsXYq8n/NaYRebNPJ/wCWQf8AJ181us+se51etlWQe5S07WESMDlkIzZwyK15rSNGRywy yJlkSzyfcCX8w9Joa73H/UNLg05/eBxsUrzx+P3F6xrevW2kJE08byCYkLwptxp1qR45kazXR04B kCb7ncEsM89fmn5T8vanZw6tp4ubyK2t9S01m9IuGurlbLjBz3EipKzMV/ZqMy8cuKIkOqUj0H/n IHR/MMuiRpoZFxqV0I7SSW5gaCNmgVwVnpT1wk/B4wOSk8a75Olew4FQGq/E9oi7stxHIR/kg8f+ NsVR+KuxVxAPUV7/AHYq0FUEkAAsasR3NKVP0DFVG7VVsrgKABwc0G25BJP0nFVfFWCK4XVr7/mJ l/5OHOXjKss/60vvYp1DOvHNnCeyUNfTAocpzz2QqeTDVr//AFo/1Nh7I5z+H6Uhk2bpKD1n/jj3 3/MPL/xA5jaz+5n/AFZfcgvFPMOi6zc+ZfLGpWK3M9laS3I1S2huPTjMTWsqpWJpI0Zmd+Ibt4gZ otDkiMZBq9qYsY0/RPOD+SfNHleKw1G11B5JNR0VvrCwlYJWWOKBmW5lCljHKfT9RloKtuwrtTOH EJWK5H8Uld5m8rfmZpvnefWNEunvtOuZ1mMLOvFfV9RaMkr0/dLxjYgf3fHjuNqDmwyx8M9tkF9C +Uf+UftfnL/ydbL+yv8AF4/H/dFkE3zYpY/53YroykdfWT9TZg9o6jwsfFV7tWWHEKYA+uQQXlvY yTot5dB2t7ct8brGKuQvgvc5qI9pTMTIQ2Hn+xo8A96Afz/oKTSQSajDHNFOlpJG5KsJpCwVaMBU H02+Lpsd9sv/ADear8PpfPp8l8E96Ph1NL21iuoHEttOiyQyqahkcVUj5g5jZO1ZRJBhuPP9iDp/ N6/nTua7FXl/5q6DJqGuWc6XPolLbhx4cq/vGNftLmh7V1Ph5AKvZwNXpDlkCDVeTAdTSy0WW1h1 LXIrSS9YpaJJGQZGBUELR+3NfvzDxajJkBMYXXm0DQzH8f2ftXabHaauWXTtchuyq82ESVIXkV5H 4+hI28RuNsOXPkh9UK+P7E/kZ/z/ALP2so8heWprXzlp93Jd+r6XrfB6fGvKB168j45ZoNZx5oxq rvr5Flg0JhkEjK68v2vX7iztLkKLmCOYL9kSKr0r4VBzocmGE/qAl7xbs0j138v/ACnrty9xqdl6 0kltFZPxkljX0Le5W7jQCNlA4zRq1Rv26ZYBQoKoN+W3lT6r5ftYobi3j8sL6ejtb3VxA8aFFRkZ 45FZw6oAwYmuKp9dR37SAwOFjp05BTWpr1jl9sVbt7P02EkhDON1A5GhIpUsxZmNNq+HbFUTirsV dirA5vzs8hwO6yzzoi3cdokrQsEcSyTRfWEY/agWS0mVn/yfdamlZPYa7peueX/0pplwtxZ3EBdH Uiq8k5cXHVXWvxKdweuBUf8AXbP/AH/H/wAGv9cVeeXVwU1a9YAlWuJSrDcEFzvnHZZGOae38Uvv YIhNVoKUP3HLhqT3JUp9SLigB+45CecnohOfJNxEi3pmcR8mTjzIWtA3jmy7Fup35JDJ/rtn/v8A j/4Nf65vGSE1i7tW0m9VZkZmt5QqhgSSUOw3zH1n9zP+qfuQXn9tcNGoBU/cc5DFIjoWKK+vmnQ/ ccv8Y9yoe4umdSAp+45VkmT0Ksz8qXNvHoFqkkqI49SqswBFZGPQ50vZQrTx+P3lkE2+u2f+/wCP /g1/rmwSkPnSeCXR1WKRZG9ZDxUhjSh7DNT2yCcO384ILx3zB5U1ibX/APEWk3Qjv4rZYoreRXoz RCYohdXC+k7zgyAoT8IpQ5p9PqQIeHOJq/1eXPbZgl+oflpfaympNrt9Fc3l20clneQW8sMkDQxv HGtPWZWjUSueNB8TEknLoa/w64IkAdPwOapv5L8oS+WNNurEXLXcc1y00NUKiOPgkapQl6n4Ksel T0GYeu1BzyB4a2V7z9ds/wDf8f8Awa/1ztGx312z/wB/x/8ABr/XFWF+d5Ek1K3aIiRRDQlDyFeR 8M5ntsHxY0P4f0sS8782+VL/AF290q4trsae2nSep9ZSOQ3IUvGzpE6yIiiQR8WDowpmLpdT4cZA xJ4vl9yEl0v8pbXSPM9trGm3ssFvbyMfqfF2Ji9JUSLmX6K3OtVNVNNqVORk7SlPGYSjuUU9R8sM E8wWryfAg9SrNsBWNh1OY/ZkT+Zjt3/cUjm9B+u2f+/4/wDg1/rnYM1bFXYq7FXYq7FXYq7FXn6/ kj5Oe01C1vDPeRXtFtvWMRazjWa4nVLY+ntR76b4m5NQ0rthtU+8j+R9L8naXcadpss00NxctdMZ yhZSY0iVF4Kg4rHCo3374FZFirsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdir sVdirsVdirsVdirsVdirsVdirsVdiqX+YU9TQtQQ2T6kHtpVOnxOI3nBQj0lcsgUv0ryGKvD9O8j /mc0vl021tf6fLaRAxzXF1EsNjI1zdzXcQjSe4ZonjmghirUlUHILklda/lr+ZFxoumRRC7024S+ jKQ3FyJRbcrSyF3fPLHc8+Zura4aIKJK+oaqvOobV9AZFXYq7FWC/nHpWo6r5TWx07S7rUbyW5jE c1lIkc1mCCHu4w81sHkjQt6al6cyK7YQrDLnyP8AmDdX/neX0r+Aanp2o/UZlvxG09y5hfS4kEU3 wGBUkietF+IipU4qmvlvyr56g/Muz1O+juFsIbSOOe7e6V4WgGnQRfVBEHYl1vlllJ40713xV6xg V2KuxV5n5/0TzHqHnjT7jRdNvIZIdOu0/T9vNGsZnmglit7eVWnjKxRvKZmZY2bmEoOpwqkfl3yT 56ttC0FHgvrN7LzJa3RsGvufp6b9XiW6MwSZo5Fa5jkkCVYjlsNzirO/I+jazpmsebjfG4axvNVF xpLXM7XBMDWdurcC7yMqiVXAU0pTYUpgVluKuxV2KvC/M/k7zXqHmDzJPp+halBptxe2hksoruKO DUoIWlaeerXPISyTSrxXigEUY7niCqcN5W85W8v1nVLG88wIfKNva39h9ePp3OsRSR80XnMgTnw5 O6gBhX7RNCqzf8ttO1DTfIujWGordJe21uI50vSjTKwY7H05J14D/dY5miUB3wFWS4q7FXYq7FXY q7FXYq//2Q== xmp.iid:62B02863FB4DE411801F95C5B8BD55CC xmp.did:62B02863FB4DE411801F95C5B8BD55CC uuid:5D20892493BFDB11914A8590D31508C8 proof:pdf uuid:3773c7ac-517e-4881-b638-2e17ad7e7e23 xmp.did:E7A4191DB0E4E311BE6BBB8B7F231B6C uuid:5D20892493BFDB11914A8590D31508C8 proof:pdf saved xmp.iid:96D42460CBB3E211BE1AB03ED3AF13E7 2013-05-03T11:20:20+02:00 Adobe Illustrator CS5 / saved xmp.iid:97D42460CBB3E211BE1AB03ED3AF13E7 2013-05-03T11:41:24+02:00 Adobe Illustrator CS5 / saved xmp.iid:98D42460CBB3E211BE1AB03ED3AF13E7 2013-05-03T11:57:38+02:00 Adobe Illustrator CS5 / saved xmp.iid:99D42460CBB3E211BE1AB03ED3AF13E7 2013-05-03T12:00:11+02:00 Adobe Illustrator CS5 / saved xmp.iid:9AD42460CBB3E211BE1AB03ED3AF13E7 2013-05-03T13:41:14+02:00 Adobe Illustrator CS5 / saved xmp.iid:9BD42460CBB3E211BE1AB03ED3AF13E7 2013-05-03T13:41:46+02:00 Adobe Illustrator CS5 / saved xmp.iid:9CD42460CBB3E211BE1AB03ED3AF13E7 2013-05-03T14:09:06+02:00 Adobe Illustrator CS5 / saved xmp.iid:9DD42460CBB3E211BE1AB03ED3AF13E7 2013-05-03T14:26:29+02:00 Adobe Illustrator CS5 / saved xmp.iid:9ED42460CBB3E211BE1AB03ED3AF13E7 2013-05-03T14:28:59+02:00 Adobe Illustrator CS5 / saved xmp.iid:1B13618EF6B3E211B19CD7E9151BF223 2013-05-03T15:37:10+02:00 Adobe Illustrator CS5 / saved xmp.iid:1C13618EF6B3E211B19CD7E9151BF223 2013-05-03T15:44:06+02:00 Adobe Illustrator CS5 / saved xmp.iid:E7A4191DB0E4E311BE6BBB8B7F231B6C 2014-05-26T10:31:20+02:00 Adobe Illustrator CS5 / saved xmp.iid:62B02863FB4DE411801F95C5B8BD55CC 2014-10-07T10:57:30+02:00 Adobe Illustrator CS5 / Print Adobe PDF library 9.90 }ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw $}ICC_PROFILE{od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B}ICC_PROFILE3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQ}ICC_PROFILEDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,@$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^u`dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKl}ICC_PROFILELnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 }ICC_PROFILE E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ }ICC_PROFILE K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:}ICC_PROFILE 7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_ki}ICC_PROFILE kvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht}ICC_PROFILE ! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{       # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: }ICC_PROFILEuGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhw}ICC_PROFILEgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrqqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=}ICC_PROFILEN=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJӖǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dh}ICC_PROFILEjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<}ICC_PROFILE|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpaRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~}ICC_PROFILE !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$0+wfGn*[jE=|J3tʹD=FwZcCaҾ[.)6[y#&[[Yls#x}B գҾuqHəGbdPq2 .J|_WTiUz6C1X58d)*"Dn"P\yj4A睃)YbTY 5s&C޹uYI7̡k&\*eB:)HUsF6RǙD%HK8؇R,Nnԥ2nV8-:>2dħΧLnpbT1+0^j?K>j|bSzC iƹɭ3aL~o:@x^R[ ~4)pw-mΝdכ4mVvu뫊EL8W-",iiuTM«ՠǙ%ILQĻtQa+to>]]>^1iLewVڲ 2DTo*Ub݊32]]A^vɶr}_ݿh P]uSi2fޚYy,<7ư໿MٟP]cKħY,Ajo|FJb 7 :Bu,ͣ%hgTZѺ( TUQhNwZKdW>I[)F\2Q&؍?=G#Ieӥ=jSJyM7^3?ɴ|.*-jJ kåG@0oj'qIK+uW2ri6Fj{ [z-md:U󉫵dە r-9]h&R&&uheq^#,y[ pNTs]Aݔ+ҟvcE4I"h7OLuuQ8F+86}Di~.ݧuh9t\nJ-JNjB3FkS41 DN)e~իzr.-6ϫ4Ӥ2 E'!d{nҠWu>MeSUہDy|)IlRz./MTmi3$_r~|ߴ bZphi2)5r չ!JOWb+5n,\/]&FzxQ H*udS7:L˫RK÷QfV]fh+PiVIR&eg[SPiL[xֿqFo8IB6t%c oKkX1\Έ^p1XP"%6Q\ȴ䶟4y-!&=H64fnaOẌ&aUR!ģۙ}*EN(OCJM${68n5xTrp.LCYBɧLJşYBIuIDc{tu{>76j* B4:eSʺ)Qim&q4${6c~7~2F/ 3w/00!?_1J?C鸼} |rN*鴵&*W5߈.*^Ǧ1K,6dȺ;}DbElg,zeCKT4ObS.Y)]C%6E]݋׺o_kZz@̈ih?>v9'-c PX]Edh"5'rWny]vZĔbSjcg=H[eL3LzeQc^idy%4EsݩZe}&8Jimke:=ǧMU]aZmN5Tj\fJnޙ(ILRŨɵ{ i$ݔ IYe9!Yj~JF,85=m `H[.?MT6/T$}iЅYFj5)FnI;n%4*(dtiw|arSs}}:~1,ֵC^N>>O'GtZoR M֎Џ oi/jciåJW2Sd]E[;}DbElg,zeCKT4ObS.Y)]C%6E_?v/^ ~Ii2"ŧ䜷Io-C`SYuJ>py;}"sϏ*쳵:$W9B݆.*ac(rK%+͙).+h_s"'i?oKSLlں8D:m5M*ٟIkwd;3a]nSYO#]v%jC=^q4 SLUӛnfBmi&מ&n-3d{f]U칪NW+9yX-4ƏhP_DI:;q&c-_txkGRcM>% wjV~Xeaç^s+h>I1h`%\ڥtXNDY*ȝxU/u`na~j2DdDH"s Peivx2t5lpf-]j[̫kJVk2j5 I>;q&c-_7VvhOzѢێfJSP/KzV/:cDTEm#q'Ti5+hΎ;YKJAs)֨P2UvG-0)w}s -'i5[hnMPigxi 6ϯU)\Rn]TȒJ^~>e,jm 5[h􃻏Xt~hNZQb[N{kہ-z+#!Pid%eS(ճQRNk"^2į$Mf˿)s`'KQeۿ'޳bFM1_w֤׮l3涺D]\Ÿ vиjTejuP Pi[*d\%uzW4#[vuQŅ]b*3B~T'+I$g@L۪_JžWk:/$@nw7S~W޴Lϋ׿(Yok0|@W`5z!i倣p j,^p?`(0哣Q{B`唣k8D ߴ/D.=<׿"AP7B.==WP? @.<]? oǧçgBO/@gOk:M,j*ՕgUN.e.-Rm*$i ?RPOd1UZ:DʻUT**bi*$g&[Ðx)eyk9Ve" Նlfr;KjrؔnM66kUaI{գHi :g[6v=n͢g<y3ʣpX N~ŃiU1Tۤ)yM:MFuL|gXS,qh_h- H9]_g@ovV:utKy/g?(l)Hf{:/A;^ Uih>lE?vcSH.!?LWA>Ja;^ *kA_o]=_hAAkjwF~%-$9PnҡD7f/4 _Sh7KgŻ>m@п(y׻t!Q~PZZGm@;v#\{ {6U!vv-_haAkjwFʾ-l y׻lm=eϛ~~PZA06l$۾q.w=^E/46K?:9_=A?/;^ }+%~./3u_S)7̬/`w}*9\Z"6ѿ;v#}?LV͛o3*{{7S-!?mIdVJ04/JsAi/ceIl CvoFAkjwCx B;^q_h֧$~ˏw {6m!?mIjdVJx{ݿ4..Js?WfBof֧} }2<{o ^B wʾحd=_g??(LO]'@W4=~(J&9Pl+]IE_oACckw_LG9Pgwn){4L]#OW}iթ\qLkJb+NCiho&6l5hT`jYTr7\oͩdȶ).guZ>](uIC,C{vRlڵö|ܨjem9dmjP֓[DȠY*ӣWqܗ ޷TzvWM>FRiȟT'mmo>҄%JQYQ/o[Ԛz^ePth2bn84M&jUe uV!&"kQsOڋENjk'4\I RPk S"6쩳u 2HS8JHȄ`^4_Z֢U[}rߦ̬׫))Ԋ%NfMBW$h6ϼPJ"/zTUUŧ)Ƙ _+W KMКjΓ7S\8^ި]UOC '/ lEJT " )?C&nYr^a&sZŷVnSPcĨzU_$NPJlD3!%FR Mhy,Y,-j'6Nęc&ڔ]h,Mcoae{*9b '.(HDd":JdRΪo^zĺЭMwNOҵ!Ow"ХLhzRj 5M]q#s>nF2>E"ZV-~(fʹ ˕KR{ NkJN|SKєD^qSu/=*Ȱ_vś[]IN0zo'm^܋HSKD]uL]xV֋0&;N6VqҤ-$kpӨRy[tGIEVN7%c hui(&ϰn;ֵ͖=֍AeQ_&U\t+'#!j XƏ>1 0 |4] `0tL*] ix̸[Hݾ +̽B.[Cҽsl%[>qslk%[>.N~VOaͧjJh5zOmY2渿@#SAO7~E'h \M.t"^vIm7)sr zS;@:yS͝Oko(Md). [` bu(qpꀢ0<[avy?@=of׳^ .K5߉PwDpiV_wKiɰ Z5_]t O_;'kևN_?x>c)*7̶֟G'o!)^W/]&*&0k/k͜v̶]n׳ogI .b[}Q$]}쇫v憇0d[}M%_oW7o>۴>1ͤlNllW97?r\NC"!l_!J(l1m2O7gXh 6kAn frW-%[ٳɴq֎ {,j18hli۴ȹ }Ƽ:{lάmѰUv!l,Gc*koY҆]Yb} c7@}t?cWyٿM,U[n*d|F:AUal5.> 5K䍭ȶOgxNmv5A2uȶ|{8Ƒsi"Ꟙ#>>9 go'>!w)8.OiOgi 6md_p.plkPۄ[c8R\= ZSvvkk~GEO6-8v7>xIx~khv"O@kV&F;Iv憳i.ߛ#ཊНųϵa9>{q[8>e6GNE; glhST77(T>!gQHmO`9Fҙ"* iy6lm+VX%fͥ}S{>vhN}fͼ$ðQ/UȖ9l~6pwxevr߿H1M;6_vm| ]$rr۶NȷRe%>:wvm} J6Zm۳`[d#LxwֶmT.b6٥ t{{ 9)k?k^>>Cď\ pm]BH^}[6gQLcg]Ƨ93Q 60B9mppxco'⭉ZQ)6|x J[4;j"-Es'Lf Bȳ~+ ^>ϛ-}n׳⽆[IBo{:yX E&[{<&F49=GE3QHѳ\R x%_ g};2+d}98-^C$% \aMl~ _\/k ;8d[L̹Y:Ex=q6pc,}C(]m؞r}ٻ&/˟@G=)LO[7G`GwC=~|:3@7w W l̖o~!-(\D>QY,v;>I%<'//(  I=. (m[d^cg?!pbۄ}_0VLr}nkj#/F\]^^@IaPKg\ o7[ie˷Sr-÷O&"?s:YV߹y;): cj"I\>K r[(K{=gDglY'P;$٥ƽ=٥z-&25k?<jοu85?ڇocZ;Q?|8D3r{~dpv8l<;=ZڴɴmdM{6Kdͽ/l~V\$mhnϭ[vK{{}JݲRQH6g,~gm /#%drv'6"X)>2\%ʞl3'o+x*"?0I-@v2dR`1 .hx<}#pmВ?~鴞kii$lvٲ] bPIVDi0e/xvc6TkU(%$J"= gMϹm>6*HX+KitpuM;6vi]>pu{|u?P"mB&R ]{g\~s~oy]};6lnO-TTv7pL`6E3F͛4xZ8J>jY|K坛豗9m^vG ?\)ٷlNMXg.Ѳ"D'6ꙟ'o I۳5O!xvqmDTog`!.>"R6r\K_r۷[=zeDar..ERG8xa'=a&lNݦ| 7I\*JvOl[OEP#Ⱦm"ɞ1HhQ?0Eϴ/lj6{$g^2Aӏx=0T%K DCl6{Dg.֚LERJI_q"F^".."jkgi }XA+8gY;K[vw%ϸWȶ2 Y+Kipɞ#>'&uKN~>Qq>tE&|2GQ|E 6^6ݜG>A"?7/G͛/Lq9/ұG^*{7n^4z9̑ٿ5 % 9;bȥg.v1oO{}}G'ǃȒ=}Ѷ$m%dg=m> wjZiq-}ȶT"QԨ~hx9;K]++Kg;Ӵ;;.=>Jdzyyy;$7ɮ׷8Ԧc=&[="T`$_p.v{[F1:EcDK=6z1 ^g~b߹)6 I'4qmp &'?t]+:{ٷIԬT<$[8hѳ/k(%}ÜȈ g ^ƶrm"w9xB\V2[CI<&[I<mh2Aro'q퐎7L߹n? qp8C|^3w=3Ȕ܃xU\~wFvU_ɗ>6.ݍRzR>E8n˱3qݪ`GwC=~|:3@{W @ 2-WY[wKh 3Zqo{/(<WDaqswե҈;S{98bI#$x<&EѳF#m GdDq=*F(Dd_spci| _/s|[6 q>B\)r~7l7:DGw {<`(:,J{x=oԢ"_oH G^%qml0I9l3WL~\#.݄>]wx=guT׻'@gtoUܼ>%dQFggMYGP/kC'j/G1v/Pgo>ppQˈ6G11<#"j\vq lvԎYy]|Gݤ{_TFqK 8Lip MkĴ'yx:G`86 bbVf\*>3>N FDٰ 3Z[4Hprpqqv\6H;\$7.:I~\\{6vn1DgBnNDqpx}ѯwOT\]W7m?gr"4x!^2,dLɎ.FF\dzRU;E)J|ErS1DU씥*ݛv=ݼ\dCH IKˀŴٰq\!e.{D6jٴ|\@#B$%\\'8N#퐊͸HKs.R2"V@!S?(f߫w/lAYqr=ɿѽo1ɳ'5c;#d2TZ[nDC/~8tkGsC(>7@ͯ|^s{? ,rTekߖϝGBٷl/s c>tl>A 3`S ig.$p}Ae<^Qa n?I|x.m:--lA#.1ضnYv-,P$OgH %݅{xPsP1}Q&-E*KdMpl"-{x9]ZmJJ~n۳gp!-0)Q'<}R{|{UY_r.$ų>MvbbFlKf.!dzo.NT#Ooba0]+)H~kod'ɴ ogdJ$f>1ˌZĔ,.8oghs\X+Jppqqm7FJlppx DMQ2m}*RmbH}!5:[[Lu]\[x _@^#F9WҪ.ޙ63 *W#(OZSEbA'w<q6$͜\[;Ba<ٰGYM'[f=> |lL:KC>x<]x>Gi-KC;Pg-Oal6JJ>{F|#~J^%%[Oam3.."Rm4'{x6y%R[tDd]4Ku-4/cn]>sąc$ҟqp D>A|OWoOK{EC7 ۳?z\A;d{ nޯ2.S4].cGQ6I$gti4r j%)_ܶl`LllŴىJW.͜G÷odkl~\÷G{;%DRm/}ȶV"EڌM\=:%!K"=2T2m6̈́/ouOpzm'.m${@{7ve]͗KZG=)C[7IڅY4n!XHXe?>]`|hM߿+w^0ϾOa`1#gC\`zkbK|$};.r%dogm$l.|EO#$<{9 ŧ6' N$<{?S` =,KJ-;{[6r$xͅl#a7|8Oa[6k@p_aN SHDi[64)PmO!v@J>SqpU~W."h %rDꓜ6m242"w6>Ipsw;wkv/͊vMj>٥-& 257>wkΟ}85?ڇOgY?Q_?|±~#ާOvCD2G[v'ksP܄%%mȶ>n^>^A)|BmĚKwavG$T)7ETmD]$]\dLV De.vKěh'>.\]Qh.yvI'8LȾlWHiB6vyH[ݮIJ%am.}ȏYIKleav{==퐏}IKs.#f^Ѳe|҉){Qp'oOO1 2% OGa= MHC1Ծ2\d1ϗ $lQB{8OC>Bz+ųMCA%2?>]GS{u](e">BٷDppl"..{| sj[~cۄd6."=\G)(.)Q~(QIl"۰{xVm2"& g ݤ\Ct]?o. KQ I3̽v?h~Cv$>42"$6 D|' JI$7{> hURH>|Ei>;-%Aؗ>i/8AvrY+I!Ϲ."v˄m);8KFҎICgqݛ6pr b&_"J8v+[LƁ =<6x8v|GT{\DʔB$x<}~NC#+Shv=n ^[髲M HqQ'ih=6ƂdEJ_dxcY[ٿ_ 9;FH>R. 9m3)Xvn&k|=bzؔR?Z|ve<^9A>MQm4 <'s`HJ -{8rI?d\hVvvr݅=H.ًAj=-5uvĝ[x#Wtzٷm$iv89vr&?gtt5Q$4^λo%{Qð;y6/gahHDl#/ivvs NQ.!!P6kpGc#ol3.^ 6Ѵ!Ao/^O2e$_'(ǾWnW,ȸaqAp8Pc37/a}j̋fͥ"~s/|o];>#TD>;qw{3+k gˬ|c4a{ 4 ;xq>|@ PMx-ps}Գ[^ ?lMGmo]MKCHxOgsf͝ i#prvϦ"\;n/lҦ-xx;|h'gH 5<;P-\;;;/#> ۈg.G!6ۇ-&Gx|G|~C-P ͉#.7f2}]:iwyHj{.1|I!nΩ}QEȄR߁}Sٳoa{iV -#ȺolLoJU>ݻ6ͧJS?T_j5$}Ϭٷnͽɞ{T=̏g$(\f3NGce%*'wvw~Li{24 ]۳ô[+>Kl;8KRHqIG!-Wo( vI)wb8vm-]37S.aZ)%/lA&S3V[KiT>{ϱcm/> q/g..1S'{Kg>>c-[69Hٚ)!Ӄgΐ秫ھ[6lxvOpF>2:.BP5!P] }/ke_5WG_}> `{n]:<[~/<=vig);_=D)Rς|I.\xw %4RX9mXZԒR[>Kϔo[Os6uD|<y%|hiGd\=Jv! AHlԎ"D^ͣP6wf7&|EpRK32v&}Oph4(|Öd2Gg؏#UU^-arCiI}?(&Uݜ[yԂ$8}Npl\\\FCyvvX+DLͥĢ.1oi%/x%̶>pu'\#R("Q>r|2J$W>.AH.>`^HD";݅07V_᭰EB>[gg!;Ox?i{<$(:@kxm]ͿQn~/2) /c$5K~[Ogkj]~۠u6'am=8{F("${E=<{;f.6)$voo |rmUųf݃_PC8}_o[8tu )U8F'ˇ)ڥ*%pZB2Qg vi/glYD ȣIm[LFҖDv .-|LpO}1oA؍7vYl= 2L$pr+n#=8c+SEq[vck03|Ds:9<߶1-Elڇѿ6]6Gu~薵~T.xz^=" `!,u1όu4f @ozŸu߈[>/:6݆Y O`%]Է^p@%Ե6p Bų ȸ<'u|pr ۥSdza{+XȈȢ~)l?PLR&sL2`T]UpvO*|pphZZm9 AqF"K}Pg=3.|v&H].[iD[ivyyfu/Vٻ'@g'tX޼~%dPFfgڮMyGP/?'+G1voB"wo,D^$w|4֡.Dkl cm3Ooi.APG-9}ᘬCbg\[yKƂF|)p!c;vKt41Til/h c%]N.~K;˗^a2 Zz')I{nHQ-'am?pH%$>m."dd3..^?sogF+)-iT$F]>٘ٳqRz=l.-vIJ'g g1[qҒDd{{]"y.>Nٷ\}ꈻ}S (|)3"#{xB 6[is>>[={: @|6'.{C|yqK} $g WfV."^.xM_[7Wܣ]kepW]2=q?rzܮ>rD5!8]=m캿7MEPrv [?3_}΂1DrR#rm$pqFng)xmxMijXm-[hX..1e}]v?Ho_ZT4={x8̇fxg d IcjObnٴv:i#vc!%Q(Ol- .Zg^l6pٷ]t-l0i $|?vqcꟃ Qziu}^C[?m;Ko){RHг2-p\\xKGyR˪xD{xn Ag:׋}e?cr88v+o.S!Pc*O`F:i2,nr%FەY^f^~`EOWE`w}YfQM߉qyĤ+0r BIy9""B)%Iv3]^$\}cVb /8t5aTFN^N=4RFqqܔ$;f.pq u6uvuIF\|} "m#.qm>.ݛGD?t$H>!go>׸4,9A<&Eȳ./o!\ [꫋m av.{1._1Yf-\{px7h[{xi'${*r4n!qWHcXơnҎB=M^2N!jy^4|Lvꞿi;>^PzIie’SQUyݞmhQܹ"`&Vϖx޹n92e^I9%Mz5UVeItwZ\9#vr9DkcϨNzTnqU$QwiW$ZJjަVqӈZn43XNķͩqOERؽl:䶫ToӪa/I/Sk$*IK},-j".Mou"nR[HD<diQ}T-2ѭ^OU\'5HU12OJ]6ђ##nq]K5]`|hM޾wa|g ـŵ[Pk~gH Q).;xKKMg)^MNTvevH} ;@][<fݦ`.)؞ck\n0Vȸ8  =(0t8 {:L{=]U퀢*pq> ?p|lJ;;6rwDN+{FŲ껷`"-c8K  'bQo3Weڠ3K]|^@2^(#^3W&W#S~uP^#|>/xC.b%}:e{QC`ekFsʣ]P.?oQ8"8vtS41ȝ|͜Cd8K124Gx| q8v24[8<N#]6\E?g0t4FGaݜGC.x;>͜9i-(>cf-/».wƙ W[zKg? qf.Iv=dz` o^]Epv`㨸 KQ\{;{8G )۵*.B/tVa{P.0%G"DȌM|>ّYDܓٳ{;|6v `W~><%`~+:)<߶Mlnby6/ڮN"!L+ɳ(6c~N杛/䟘?qWxkGsCH7@S{ vcὗb%q}TeG3僾;w 06e~1:sq[[|{zf,ga#V΁d_.F>]{'w|ˠe3#n>?<=.s3&M-2D^rͲ"/g'u RF}a !p˪=Il".^=o@.e-<qSv{CDDB€]Tps%[{Hv?G-E=WDptpQl> H'Ǵ@X{m.&g8ͽq![Kjx>)qsoE>{|?OTU^.ZyKE3UFx%ų\^ ;sD.aݝ^p2]UTgg;EK6;<]rg: 2>nA8DL$#GǴt F]#9e}pMϟ-)\J~os 26F_Gu񾊷虶>3tѺ.xy^=! `/ֽVOާ~s}kͫgοW6$ϫH?1aU9޳=c}yݝ~۳m?ޫg9<Pמt^sg[óqߪJWW{Խozzyzx]]8G?e`5ik[7&E&Թr&bt(rUzTW&3{<KK |y~R,CTjY/PhMbLY-D{q)47&o^g%tNnP7dU=1r5*B_K~6!pKJ6%ye5gWT5^yg T+zv\6DnGOX6/k16fJ'qXnY-*[#M:-n޹sdۍ]N*UPBCU6HSwؿ3.YQI5^$(ʳ"8*UDJWQԎ27r1[JjXT-EܗSz-kv5W9%*KK8R:03 Wܪv/jb2N&sʶP]vE2rY1V!NyG9tk'snd2N8od줽U)DȠ4puƛKKIpfVg-|ѝb6LpdǨL8bm. K0E+g \mm.(n%ޓnjd[{%fvwbu'uM-&KvB i$%dJ2?Kv>Npߏjrkx )2}wtЭJ4Pԓ׵KJxeZnooezm WL, 5JBm11-ϦiiIm!-=jT4׉;eDjS,S a2#ùV}vK*sUFTz;tZjY4D`ty/5gHw5*΋7YGͻ+5f,*e1~Z҅mm+T>rSaۙ|-;?S!4rǒLxYZa -LiUPӉezJ8Klca6˖mor )Ȉj=7izs#,q2jI@xS1Xzĸ6 VO)Pz:rXP雰*5GFjbKKlRc2&YYV.g_6ʣH]>^C3b8f:7 Le^/ G=gk,k.\1Y4+̪H Q)JsoSk4׍qYKeƔ{Rb+xC,YcGh? >0w} dr 8l%夝kL̀Lɢٳ'.pndd/pݥৃ^`߂Ga{}.V"Ipq(Tlspdipp 헻FU[U\ "\On =q \퀳7#~ 7.<=PhDx6>#˜ v%{=MUv.߉@+~w- .Y^t+?ppDz~c:I(/|G}扂kPFuŊĞb&9$͸<,SIA`G;>f 5lZ >BNghw,wdG[HtȌ!&%ժǂ.#.a6[;Eܳx?R[;[6/}!<D\]ApmEDpq~0 Z!'Oph.#Ru b˳.ͼ||6s3-uW۴8F՝w̕[ !p2{B*_Ѷ!^/ v˄mRA'Y;6dD#C!,rv(o@_ʂ&ver~$sdI_lHGto9snRkóOdq8>lqKJݽ1Q֎>|QwGn۽XٽM,S.kg.AlCe~1:w8}s|Hđ?Wg oq88LJ-H:kf\}N{ywlݞ׶c*\!Iph3{:ϳ#C>sGy|#u؞4(vmoY"CEGgc;F:ˏ ,x8>=\'Bm&V.vUO/2.?Shû+7kp@kV} D^'؟p@0UA Lrϥ)\63 x٥{#P_A'w0 D=}Npv!GE.oCFGܡs#i}c'ɭ[6xٰ@!U/XGٴ~sH<}dp۰#gg|dKmc|Iu.Apv{]ZKf=euPG"$^jkHOos-6wy}MI4(ȋ&}|$eM4+ =s1lfE*^cNl}=fݛ6p(_lC ܞLur?tCb$pqϵ“.~F]IKbv.A~c;22]I}vHl Uf3 ;)\J>^S9YdGi[=9Yi'${+jF8x5%/P/۫Q5K=Ҹ7|QUsgw1ڤIHPc*ֹE:=›b*5@uSXBag-ԕ}WrԳ7uל'P*}g3fPZuM=Nn2-q\˜l:u4ڕ=h2y.\8P-].`GTZmmէE`T_dPZJZ˪ə\q6F Ok6M̭2M0M*䷛)vIejR%8L*4hZtecw+O9vt9T WnxAT:,iŖ͑o4ʣ.zy8a+y-qLqv2ux_l 3G2m^/sd[jeEU%G!U+eS8i NyIy(cSs~0m*jKv"LyF;kq(woʠ$‡)B:.j@F5c͇)$lJmB n6,~557zPQӖTG,Z(*]6^M6)A!1?x67[[6צSp^4CL_{߷+rVj. RZm$J3UP5$q洡}>fu}VlF^ܣ|5 >a( O)6 DQz&[ CeM,&ifԍxSmiGQ|'~ [Tj܆j\B)!ҍruDm~-/Ļt'9ZnjvO*dI569 HiIpi dhQ_ϣK*nHejndoQ&ViP+Q)X&GZ(1JiePwVt͇Ae=Ho:xSC\2[+,W=-*.%.- xZgɐVwІ+<+sHϛ#K$Sə7Qt J|kdYLPòTnW5j{Hx/nl|f-jxLӯ|Ͼ;SMV4GbFj[ )M%x咖ukm:ZXKx^VY tVy,Pzs&{,zt ol i0wIUE+qf+w|;v=׻# ]x4-Wbqv-բMQ)Y. {}N3tJ!F:)\v.o^H1rė./E5az VEj\oT8k%uP}W:Ö!_z5ltY+kRRZ=!V]&nV=]}TjҺ񶔷oWs,ܖX>m5q=fzt,W5؞:k%uKIzߢ -TZ/!0ۖrTLrn@ Ӿ2ƹΰDF2f9uչl?]HTi_WTVuVeyVuH͓KI6f-oWmhlBMw\1 7BUu'ϡ -7]BmIg:>-w[!CJYcS)O*)L}%-YMy"657Qped\f2ş.>f4y񎦀LxxO`0۾3~W ~gg Xcԑ!2l֊Ky=PL{9;Rؗ|ࣴE@$ϰES(.^ Rv<9Vˀs т؏sp6ޒmG퀣ؕ{bp@YۍRl2QcfݝׂLݻ86v%ݻ ./)0!?]͚vMj;_~x|Iip zϵ]_t O_;'OWAx>c4 [Z_wnOɫN%wvHl bt}OtE{j3a#jdɳҎ  Y-H-}%2y# ;7◳KU[?gM5$xv/u)8 0!<Et@~@ Kj/|m uq7~wq^ɷa WN^kbdm#3$?kKu/8;_sF\DpmKwc3#GYpv:1>!>9mY%'U۔lM].O䣗1P֎>|AwGn۽X=?e6W R/kF۾\8e~1:TX}^$KhݍQTGIl|p԰esgch./>^MDS.^k;h͑!>!5"Hx{pHJ" .:1^dMqvOnZl". p-"ppw~|<:|o[8Fxe[_m;}v@,]ڍJsGNxG{m]8E@C<ٚ.CJmx[; nRokrOf4 peuQ'펎O/YVp>1yx́f_A!;~CNyv_֡U 1lh<.$l;ELOYc>mA;[>/l[ۼg|q\ ?pŕ9@6D{vpޒ!׽]d#2.-D9Y{8|| Q?~ϭ؉Gٴ8oIs8EIvg{ ZNy.t}P~ҷzrͲ?xOHmV?Dճ>; qw{3*kʓ0&]y'1_P+Sr&Hje>H\\je.Jx[ I -S1*-R1LʗZ| %A1뒟Iջ*tu6,GzBiIIl\ oiWw#l[BBÉqQ-;v:Ju>Znk3Aeǔhm$k(7 [F,IiLrcPmLRJ5*ئҩTDh?)l2$ .g2hwF(;cO7]5wmD]OVѦL!81d҂+lp<Ҏti7g~w٧]W3.q.CNI*u:#y uϪ+mzfӶ[~Qا 40K*tFYmm(3>Ki퉹A&ԍDyIwn+&b ZĻ&]MRAu=fbI[њ3WUV9 *d(tH}>,xP BXPEi E+mc0PhJP$%>$X"ǃ v!… D3If4XJ;(J$ 4xQÇ"0hc4Gax4 J$$DEJ0`æS!ŧSicf$0b2!É ,VJm JkX\ ҭd hKz:!S/Hv&+{~ 1^iǟJ]Jj`п+}WW{.:5 %:lן 1mϞJ}^gZuڻvYٴniԘ2k4XЮ8.J_ MmIa:JH5gnkWg2./f닍ʵHxQ/|] йdrniUXL?K]K]OsQ{Ùs A쥏-{uҦ7J~MX50ʌz4ٺʹume5myb1ֻŷ.O>mS^;2ȎG Y(0lU yc̘fJ_v릃.aqͤ̑ʹQ;-F~TIKi g9l7/ԉ&Ҧ7Hp? EL4QRV[7YMR`ARæRS|fa@#Cd7$8Km4RВJH2:m6Z}:< j$(04aË ,fJm JQ"E41… ;1!Èqċ4h PHBDH:u:G`CҩpөtV!SL"4(!FCQCM(m $s(r02ş.>f4y񎦀LxxO`0۾/&>c=>Ǽg_%-^ѐ ga2\"Q̓I+p$r[ [ k<]Wr| qmwT۾!9 #T_1௃[;{;-^[`,Ȟ; 4lKtq #%[I%Go+_j_/+ހ͞w|Mjͮ_~x|Iih zϵ]_t O_;'OWAx>c4 Do21br6鸶rĩ.S%u= 9p'¨/5K}!Pgk|}xt'،4Db"1\E]]Z]F[9b.x۳kmm2~L/$." JIJ{vp@w4>I+d]U;4/ku{;#쟹럵;!>AElKj}pn]IR gkPm/1 ΝھrQW1 )_UF4 ax?Is6e/n; /GC~K(LT5! ]x9c*ld:ӛgV۾\856WsQKqK߽Aܝϵ N֡67Ti)屸;e]2ÊS8=;jYږO..'݈>F\n EIuf]GwBLPSrgwX5>){9@jU >b?h˾C?V/oc@,eڟyqxQ5%ddKKGF=.2v"Aq%ͽs +OC?sesos:)<֌SQ0Kf@[_A 5)?Ta-6?yj~1S$%@{=i%Ƃ4xu~wz~ L6}p#[:Lm?'pOƏBV/GȻE;>!FFٷ$|6{RǠĴRF]%2ږ{F oq7]$[-x]imJ}퀼4{*|_k`*D/l0䗷I8,^ vW!lC=#e:F;1}# 3۪?6z56[5%%2|57>wkΟ}85?ڇOgY?Q_?|0pT9H|s1ґ2(vA ?sIa2RuK";[coΩD}|01lnYzĮn B쓛̞JϣNɳ)~6cqY'28E\G/:b}xb9X_S`)p}Tgk/j`Xl>A D5}pAmnDFK1|5qwr?2ˊ }|uF}扩g{]R>~1}͓'bS-7[G-]ߨ$ ;vˇDFd\E]?@uU2؟1_s_si7amie˵}⯋1RÅ?gd?}VpDʥ9<{4>I l{I~b8' l[^ gm|yt.Vfk$aoO$$@{=i%Ƃ4xu~wz~ L60mjbq^ymjmlleC'b"/gX;e]3KQv֧w2}".\]Čcd&̂vjIlGkavIcGsB[%)Of'n.b|@8C. [r6W7xY밾8t C qm{]%l {ڙ]9l1w1K%[ q(s3]N>c]Qlji~VN_Gu뾊蚶~3t.xyE^= `!,u1όu4f @xψx87 b?kgA ZcW` hxsxͳKo'}P.GogI)y)0j=< ./({ *U7' `6+}1^Ns/s%@BOi} 3;g|Z3cW_^Z@2Z'#^3W&W#S~uP^#?ǡ"S!q_WڍG裟i p/>etDqx,d;x]2]Q\E][D=1أ.HvzK>s?E"?S/0^S>n\)?g N PD7|G[%tEIt]]I{)._(H"%tI5{>c0J"JϺfgci|}`fG+^t!<&+%g'uٔ,L]O䣗H֎>|wGnͬË/E>_f5Z?l6Ws]qbA@'JOkC߆\h-@)?J_L7Ww> mNx`c(N?k7}Py12̓.; }A$<q;%DIO9{7'.s.oѨ_3p4 j]Uq-[Pj.$&~ѬR:!GIoy~Ҕ})LwC(c 4x:89ě|S8F{žҷzr̲?xOHWV?Dճ>; qw{3*k gˬ|c4b{<|D 7oc1JOŶ;-gĴ|VfHOAvx(uF`$◒v|H.~ĎbT5O@ <7@kq]49++S]W_?w@Ys>^.O߲0 x?l =cfҿgz>j5OmC wOק3䟨|>ią= .g)~l b2b Hr{?\3Kp˶ 尘ryˠQ1lD~tI\%űv(Kbm>/ ?c/3ї2z <jR\/ph_wb nf;^+O| ߮w]tLAI}bU#Ϥ<2̿zcmNxb3(q"Įn @g6ī<_2f7R#^Kr).; ެ[wŗT"\|U/h|Z/l6Ws_}_rw>VQ4c7I}h6*q|$n!4l%z;F<'[hhH/!{㘏&$ѷΟu&`*AU\WSb%W>eg2È.xŀ=iq=;$ ~Tr>i_}Β>,%]]&1K' +A ! }J{9ߟ]yi1S}RĂdO~և 3wĸ[Rf.oޮOB|Aۜ19)~׾otas5cleK Gd*8ј@_r}Gwmv?j;vǥ1R.$=#!--$s >JznϣO1{ ++@-8Ϋ}Q>#KWG@E+ѽ^pD3kl^(~~c5?6Ϥb{89'#>Ez)~ҷzr̲?xOHUV?Dճ>; qw{3*k gˬ|c4b{<|D 7oc"# ž<a>+~R3la#(*>äIO1w]_9ޥ#U qwG]ސ5w. R\;,9@xcwkΟ}85?ڇOgY?Q_?| z,\?>R'58|Ğ/{4nOgpp 2#`q1YMf>p,k!WaG6Ƹܝϵq<{ #&ŏ䧠|}Z2ϊ}_ qw{&2:;F<'őϐB">$swĖ4s#ހVs@]Ot_]#"!Gr~X쐁S1~):Hcs1qMW@ISgOo1ōl;gݮA1OY|+%ؿp,H!HIh{7|K%'i^='m `E$)~׾os3CleGz6< $>f;9!1wz N#o?j;v+Ǥ]o]oTqwG]ޓP x\)jg( R\KWxwkΟ}85?ڇOgY?Q_?| z,\?>R'58|Ğ/{4nOgpp 2#`q1]?+\eK(mQxIw6en; /Gk(A 85}p7 i0$%=;8і|SHn!4fvry?POogFh"~ swĔ4#ސ jaq1tT -Sѫ_ N_8X wa/kG}$ ~U$4>I n/gISgOG3lX޿ elwSVfk$a_ûG$#@{=i%Ƃ4xu~wz~ L6wΎN?k7zP!2K~@}Z3ZcG11wz N#o?j;vLCxIs'9} gmI'OA ri/z@5_7|qz%swG9q-ӥ逊W{_ێ.tg=K`1OHR:U)Oɓ}#o5}w ;6-.A,ɒfv'iR7xjL:8F<"a{M^X]-f=*]ܐE^JȯArTv<)]U:qV&ՍY6NU>ߵl,[^x[ *cfHRu0ۈf{󦵛rHNbktU>H>๱ ԗMU&1VAEX"+ގmG%1oɫ.Kn*`iA\lz4VԘ S%*˾S(Ȍ5UmJe%ݛv}?Q VjPDڭZ/? P HUv&y0UX4!6-#}FܣQn2N6TuAfHL^>Ȭ4Dvm#N=]G{׬ڛzЪ3U,tF.f4y񎦀L-xO`0ݾ/{ď'c@ h9Hͳxx$c@.7{.7{*vU#.IӼ]t爮`W_)UWg^%󫠀Ys>XzxI#]!>˥@39g|Z3aW_^Z@2Z'#^3W&W#S~uP^#?ǡ"S!q_O I!SF~g xs"J|lk bX\hV.F֤M&w& }é[6U2Eǎf88.d9qwgKΙW9dDs[cMSu$K(5HV^embXS_Օw& #E=sؒs?H~F-}Fq^wbl)b$RR _+S=/LmQFJVa53AB5z9Y-Qc$EѤ;x%͵x0SMFU#V$ٶo$?;vKP ]56r]/wmn>I54۹,Wv)4oTm2dαoin{1QMN-]*f>e1jiQ6NSU9IxcΠ5/1TqZ65L{qE׆&}–/Ul'%$nu[(COW N2՛o9 UQi7wɵoȜ ,MR}mJ-Jm8 .ζT(ͤ#^r, h̥d䘑j)&Vd|HuTE=lj ;oDXqc'x[3e|%Z>V 'zA]גqUE9dƇ;r"$I1_Pڍmև0E-ӛ.vZ)fġmn|/Y2R[9e`cN_z<cn4LѼK1[Lj58+ -5u-(%āMRd5)r™%ag=8;Fu 3R94$-xZPIfN6tĀn9%vim'K=O7\\j:n2$IwNQtZq {v)sRԱ*ۢ֘t8ՙJ+k*޿q ?ErTߟhi庭ïnEܕۇO6F:ٷhȃxS3G,P:u^MBR$N؎K6&q\6A[{FGC&tˆtҙ5=Fo-^RWTgBcϧ"#bCKmdUi4#!|TyIixˀl훮׽hn;6]HD*XWC-R"\ -!48$(<_2f7=R#^Kr)8EGa>tK>lR~3C塾Wk&q_}΂nqclkQZoGG@2aHJzwq', ސGwBi#|~V7ߐڍbѼD@#.I)CiG *.bz#@:ZW|@,;8Xw@!Gr~[#Ϥʾ$w;JStb&~C]&1M=ϲQ1cz6oᕳOY|+KpPC9ғn w蚶~3t.xyE^= `4hm q%BTj$I)FDi<&Z)~.ef|Rwwb*MVEcǿR PnJS}Bk]t*ꨁ זJ4OS&O /H׎ܯ niOΑyiϪ/h׶*tzPiWMFn\j&HזI=rki޽5-s@5- [51?T)i 5pQ)lԺTNLX89^L! _H6kkxN9Riĭb &C5jYxjzEZ[RWU[Su7髓')51n.wFt &i+cLCaWV{V{@]ReJ2ߙS~}-n;3MFpU3d,.+u7J.*}VUv\eV5QrMzUBynKl38wsex JZLGl컥צA.)…Obt ^ T"TdMpk,{54֞vl=?Kw lY#;ڱCɖ2Zz^}ZYrlH+Զ}ݓl8.Ԟe^Oȑ֚=ЙՅ[3m!k}dxIh. S"2PIWo)qXRj fUT^mlb#}gϬL$gqfkamf<uKaSeT]E48<}bivq>um>,MNM܇h.aIZQyqf \륈&Ғ,Enzx}x֨5Qn[U*u򁋢X:K(uLN Ltלi1}GvW̚?\T R[㘶fC|$mÐZMQR@Y}YI!|i(s#S31f)+,׍r=:aq-:arۗ7N{դZ%)_.(`:AՍ2^Du>51!לe'n9;x0s:bYrLYdf-]EfاQmEM&JhN8ږ%雫jv)̉ %ҭJ̙^5c("nHR(,ަS$)RIvP>U]\ombh:+<byjSQċMi צ;[ƘĵԒ''[&SGb;?u𭉘vکKfد4VZu>E[L^7JvQ :j[dM V6c-nKI귽ǐrL]9 9&ÛIGSE#}kgRA=vea?(%.Blԯ Qb..lR^#J:m}5bUYMy*Ӣ߶.Wif@ιf@’íRoa?$ͯa2OWnЦF\O:[0۟. @,e1r\lőwM%rQ$՘w>JJ:-o7E#UW:S"S@9s!+vuN-K:"۱)RqR(G9^{4~ߕIv}f̫ePab|ʄJ\ߠYT)N-QJ35A7Zd[*hN7>MVf$Ԧzdl )fːj~ThsuŚ JQofP4=2Ub}xþ,ʬ5JZGÖJb2}NMaCTRqR(GQ?dC,YcGh6 po}(]#˲& 22:L|T}IT߭߭'T&tNwC"R_~PW_xήfO$Fw@#%1#]!>˥@39g|Z3aW_^Z@2Z'#^3W&W#S~uP^#?ǡ"S!q_O 0ulmאm)˶gZV[!yiskfy%iyҋ@ZƩwE#0D=OƸܘTj{P.:2qmjT&ZnLGYRK*k;R_dX{ܗIC#2dװ E1xcv̿H5?TFey3!RbvۑaP2Wiu ĒRӈJ=+xg'5l*$r]n5ʻ֡WL6=:)>vR%-SMzpӖmg2Y۩K nO˦¹a]7.GkJZD%JzdH[DP ՊOmZi5k'#գ9"TddH\HCQFBIF?=v;s􍤍F)ڍ{QOgkFx4wmfGif MRd.l۔ q+nʱ1EEoE1u۴2JاT|[ ZDLhhk;t46FǗ8m5B]1bm*]Füi< BU8;AM&%tFaצCڔ jUEv<ز3XfKDcymm(Ԟvmuk0EX'i ` ܘQ-%dCl))J}Mϸg 'k>7c7iOy](rRW]2}:C۞(JU6E jlkAhj7r#9H;uG mJJv2nCx顡LAZT|1gK4ggڷ! $ܰU2dF*R\I#RM͞ew+VGa-J7z>˴FO[pz }Ѫ{ Mb[mjShʦ$סm@ֵOl ZDJˑxOCSqRS=!ԊV3!KZj?Q]sVz84J ђ8+NCRrj5n2I~-W*.:yR֤*#NXodJ6`U.j rjHU(dSgŵTKu)JRZRjQV&4Ut61ZH4d]:VѺ'УH.L:joH^y!mkWmv-7aȼ1^~ĵ$y.ʥ4T/3RQ Umzw+S;3b^x2`Z_̡tW+"dK^uj5:obK\Fujii]V:˜G:s4յy9@*vW.7ʧ3 Z44ڌQ luFn.A-HL'ߐ,z`I:f֓^Wم#]1ź̃e}Hܗо\4]okvN`w1/jn:F=ˑ`u78RgQrDrnM=m,6竢`n٪}unYf~)vBƹ+T]*g^ٶez)WK(Yv"hY&ȮyYKו\ֽEWKuKDvVl'j; dH._TJOӚ5yVCgl%1W /,JOEC_aMdO8SS)2MEiӈ 3@1UlX]%iQGUu2Cțu*{V|o 4밫5H/IVzL0O[zV$bؑeVηeuV}.YnR٢Hq]:M!(FJghGm(&>R$-/II3D=Pb] ldcZ+Mk|ݖ :۱ښ{rUA܀OCe6P44y<_2f7lL]_䣗HP>|wGn_ϫÛ3>_ho5Zj6Ws]K1OC\nNڊܢii/$%=;8іlSHn!4fvry?POogFh"~ swĔ4#ސ jaq1tT -Sѫ_ R\Ew{, ; #z9<{[#Ϥʞ$z i_}Β^$:tR|_k)s_j6F,o_2~;)}+?50~ v/ݣNJ} y=R{Z4AnIW`xaz?u &nrw{X;DGI F'=z(\Qލ%|Bc>ϭމ%jG]ރt="OAj8K._O^jiDnJJ cqs/6W7xZ;ѽ̯z`"W{]"dFX |$M'٧ē̾>3>S8Fy/O+/q\#?uEcM[??`GwC<{v 9 _y~^1M]J=>k gLyөI) 4_qz3\KqRQQ,YFD p eϤqlr6q)9 d+_tK-U/,rT;MӪLB_m#/%$)I23Og1C#Yo/-koNZ-ͿgOg?3|*Djrsnu]r] /NŇk_ՌLaP*5sb"=7 u! qȪPܑxuso-[2]{Ur/^,,o{Tba e [.440ERTe@dv~́ 5b%&mj%Q3%zFU;>Ǻ;BRi@rb*Y8(w449{t49nBe-Od|r+d:ko&uqꔘnHyaGscxKu}9Y83S+R|b ޵ *:ب^nǦǯ6!mZRdy.I{.&,4[_ykv~qkC&mOqۉnf.h`1ZBtm*2ؐ|?"4ظUUKF~bK_ 6ըGF֕USɋ&4) /Pzu]XbõMԦBɰw1eSh:zWUUJ(nHya#/o-Uͼ)nӤ˓YvUZrJ5zXP}}D)'inIR * LO׵ِ4AS1ͭD7doHʽ:g\YhRM!_lEK;'n&nm}s6 iJs!LZZJ W&uILm3v$U)0ܑu7 rpfVF7j!T*uPݏM^muCڴ \]:LYi)zҾUZֆMBڟx[ݳ]-cbVkvۢTe!@~;Dy^*]Yb kɔ)5q㛒]ŏ\:,mCfUi] 6CO-:Ȝ.J*}:ip.Jė*7 mQޏLp!wǭ+z6<%=MLhRJ^7oXX :mY5Z| ]clWMG+=2uJ"ב>\*K.*|2M:po`ɸU/iڛuJ*]r`cj|QWן2TQn>Jl5l tY1$Hlxbjp,".k5uyVWy49:O6 81a=wxk-0b=j۳7o鎕 kթAt\1%(Y0vjZM6 \DRev2/ܙ!ۙm~"-7dm RuBp-w(3j)d~cqaޞ/Zᾨ:8]t .=/okz΅&MBPJ]n.) F4ʖoJZeڝ\5awQa,m1 ;^Fa|!&ݩSʪU QCL㉎Hioq5D "[uO:XMeUQtϤ5t+*ݾm[ʕnCۆRͥ3 ۛ,ۻuč6{Z&YHWjejʖ7+ g}b:*4QC[wr^4zfnKYΗMF #9۶UK%VeV*"fdz3 (J0\| PCCLWfRNM~U%>pۄ- BnJY"*wR1R)0UjQDyi3 tAjqnNLXNZmV< mSn+)vzfi5v[=^7gukO7ƝlLm˲Wq=^*cORfaASxˍgmk ^Y-f9 ;g+nLu鄦T^Q)UIiS61eo[7uޘזn^|l{=~ZL҈@ai]̐2&e*dO;)t]}Y:-E븲="rMJ(m;-4؎O~T&dp9Un۵%3uymEsd GRzB=X)%T*U:1:o[vOC-\x=NV/-LPF';qP5m1TSl"z>K/cvpCE3QL6j2f4~56&jvcM-T@K{VĨڞkݽm[f΄CJ5$-.LdKs٨.jF`Ӯtb(tnkh˺UmXY 9\QHڀўCŜ4 %ea,fNAܖ%-UD:%oFqQcz:Kڒ➇ymYhVt( %iSR1 1 ׾ l`1XJ:H.1ߋoL+Go@&e;$eGt %nv[w[SO@ )wzL @6+$dOFfgڮMyGP/?'+G1~!}BEC㦿G.8Ɵ,j(sM̦|L+OuJ=im="VT2u/J ġb[O4N+Qm"3aT!ơ!ęjVRyyFCP(7$2\TJE~O"AASa!FͥU( fwPl{RpWcM({\vu"{KkD7,h-qk PO,W-'SWLZ|w=\FurK嵒OmWp\nR(L#CP۪-\EFi#7o8fRVfp+9Q9)YE62܂ɹ]L>S`vÑurXyZ)J8S=.T)) u1 >PI7.^f/CFn>vj|W w۵*b.&-m Ity?7HT[,"ASsNf̈MCRH-oVnޙw9FՅZ.ơq%2‘( MS*vݍTW2}<8nc8Vd˹ƳS8ۜ&2NT[ϭKE2{\>RG7[ϛٗP7MdRi\KMObrzm6sJHKңwըI^75-qjOT’:~Ƥ=%,μwg{H0/S*ڍԭaTwo:q6t5Q\ƠK-JEP39M.wWk7Eַ}O:P0F[q4Ԭ6iǗF;Ӷ%zÏpȌmӾ)!۠JjBQ;o3aӍG{MRʲniܹlS VYCq9oE<:vdNM5*ڒZlk.mR:MxJJ&y´zSjF޻M9:Sgz%Yi>\W"ϸ a%gcX~*0q.p jMbcv*Iy:vn}bhU]%,A@ױ,;G ˆST5W#X["@߬q[;' )mխ- ꯣӓ-]=-Eu[4xw#ȃQK3yǮvCVfe7Nצ]vM6%5tړĵ7,bI)n)j\FS/v+ .`ڙޏ# Y"EvbM'*VK$$:qTm2Vɨ-Hj9O2d=S*5mFVE r BXaXnvE쿘/ls3SځK-fۮ9R[Za Csʏ-f;{NP̫ݵQP\r02FG\^ u;קK!Vr&;y۩]*w4LWf3qILZc~a3 Cٲ-sjD\GSRwcTdʆ28ɟ.9حS4xk+FZŋWwdz䗭Gv( -^kz:ʠ׫"or 1QO `i%W7^qr-ꭋJfOvu17RP%*Zݭb*<׌Ctijf4i)Aø%76,Eѥ(ˀrV1>!^qLfSݥQ!Q f t$V~3"Z^imVpᆚ=-5Cd T;s75-};xN ۷֭iSZEvPMbZ&ǍT4ܕz|mT.#E4]*LaYD-D#НoKf~ك/>SR*K6|+m1"5k[6ItMQ\lKqI(ReMS0-dA-ŧaFdDD\;]=ߺԖ~Ϫ.wЫ01ۃnfC,2Ȧk14{SVrK52B'ٔ1=R#^Kr)sGsC7@΃zg͙TX\|U/h|7q_5+B>/@ކ'}2]HJzwq', ސGwBi#|~V7ߐڍbQ;}_zbs!'ރWs733΂1\}ڍA }J{9_]wh0Ӏ}RdqO~և 3wĸ[Rf.oޮOB|AۜQ9B{O^3=$6TqwcoOFccGwF;<2=|F|$C>|RKW䧠l4 n/@8ҽ~#8os+ޘ~'H_|uqw CsΞo93akQwҷzr̲?xOHQV?Dճ>; qw{3*k)]]?S]#kle:>2[ѿIO׫ >su 0`} xV\kfl3~e_r;^md|oLORyj^U\/TcC DLUB̶YySM',k&V,Oy-N35sVy5ZVUUqEELu))ZB eTN߯WEInP+"0~cPUYlf;gQjqғQxJV5UD] -^gǶ'V)u7ٯXZUJ4(T4Zoh5V&N4[ ҴIf4wv&իGnj6;SmFr+KU:YN?_7M#AwMnꭵv[l+KsԩmܐbSj+.Or\8:~Vk{+3U+tnLDsfTh7 Ong ^OEr$v\ԙW?FU{70xa8xw5IЭ"SC·hY䫎| rQ\J]4e*hl#zg|,R*zhl*"bReͩ&5+LV'O'iCz|JοH5mQڂiN뵹]އێw$Ѣ϶rO@Yv 298m2F~v]z&ȬVWY٧LJQ궣K(4*S<1O[=o1[TT/t,3]Զ^3yFs_V`ݫAzTNiSKqx{z;/]H5?w 8WX[|Wq_ `n]H5?w 8v4/rU˶&yʙ$eK/Ys''H~K֣aǧS`$Yi*ڷm(Ԇ& fSԽsҶ^elK2۷bǤ]o]oTqwG]ޓP x\)jg( R\KWAw'}#u; wCkđή]YeҠQ>vn@+~w- -Y^t+?ppDz~c:I(/|G}柀|H_cБbr8$q~r{?\3H\~OFQGY .bmsސw״ !/ Fc|'Рj]AT~DR^֞aݫդQȌ}[£=*ݷ._Шg'5TTk5y; MV6]F#]w5*1ȉN\ sdĊu̘9.ZBD6xN/jAD-keܛr۠[nZDөO %.[vfKI|y{ jv>ck~+eCB]_:G[{>'~n$y O%z uR8Hc/96/G%swb = K6ħ<_2f7R#^Kr).; ޫY}sfKv- 򿦫\863FctϠ5}7h4co?I}h.)q|7Qv3j;F<'Ս73XF2}bϭމ%jG]ރt="OAj8K._O^jiDnJJ cqs/6W7xZ;ѽ̯z`"y PHy#c>I.i$/6Ϥbw:z9{#>Fz9K{8J@2O>#GXVp7Q(Ǥxѣ9RZ4Lb +2:wɨQi3FtHNXK.kAx b˗:lΌʗ"BP5%/< &efVVDPn5 DծP3R-ڥ|KiC$\ -FTGJ,0}n6f!h33>?g Su*9oÉ=Eff坂@?:~. 5ix֓jybՋ,_EYc{|9*NK\['M1 4Zᥕz}מg-G5U71&hfs`4Xv٫T*t5rv kJKm<嶳&u7eicM3.3=dӠYFȳT16|oԉȕ[BPwZu 9(YjtH[u3h:vFrN*RlM@et]p5\U7+zp iSJCZ2ᥕCw\-r`{;EsJjLLQ[w+仢MQkvERe[*rfRWPܔ;KGF!ba{WHثMd\i4n)9=B~V99u^Qzb)HFfnH?Lzն1F577cN _TI_RQ<&woMvJ`+6QU[zY{wkO^hxFv]7\rx6ܚn'L))5W碐Bb$zznFjF'o&|!YJ3.5sZUZx.OSbi0=M$4MiK+ޟu}YxfUaLuI7 )1Vj :rM\ZRi2k9mɥp2Fޅu4'P$XNme"έSHUہ.-Q%KVJ4uUh}gTXg3YՉonm>C\G~[zV"-ۊ^5jΞ<3=Y*?G5X=&>"-̗C:OÕ+U㮷L P]fsLuRN/!t l2>]9i;H IV3c۲r/2 z;QbC9Kf6TX6AҝiO/?O/?O/?O/?O/?O/a?F=OkSJ7l֟&ִGIoÚSj`ᝲ=j4v9ҽ~\tFԃW) -a kwt6_ ;[پߜro #[iõjm =S^Vؗ-~U}M 24.mks#gZV.eBEє[? W^iRnROvd"m@Ⱥ" |Q5 sKsFZܵ)9+W\W ZC(^ע:%Ƙ_iq@ } ;^xcUZ[c4BOM~?h6_1'M%B@ Lst}Z2|XR?os@ϣk>`&&XOAx`z3 N=~@ V]$4/1EEuA K}\nNڊzaHv6#)!1ğg֌G/zCu] g7k}X#~C?j5Gm'ސ#.I+Dm)FUs@eK=e.%΁_wb^#ނ 27pu8H@Iƕ!LE'Lb:z9edbl+g"wҳ3^#Wb?4T rߥ'L.4 x٥{Pba'w05Nttbq^yעI ][*8ј=QFx1;oAO+ c)>o /A.d棏!,- cZg??4s,4=}5lgu] z@ld~:y}Y7c$4NH7}% [RԨ'StojjioF6F=6RߩW*RNzEF9dyq gˬ|c4b {&;|@ 7oc#x|t \c?IV߳L7wH0JQ=$S~S~kRc4BOM~?h6_1'M%B@ Lst}Z2|XR?os@ϣk>`&&XOAx`z3 N=~@ V]$4/1EEuxU#Ϥ<2 rՍ9; y/w?+\~wA)<&ٍ̣aec}r%Fq;=>t|7}_~ٟE,RfC| LQ*3"- q;j+| b} #%ď䧠|}Z2ˊ}_ qw{&7ڎѮO' cx /ѷ̟zC&$ѷ䧾V\E]?@u/D~BHKTjWG|:|]yxz4ގO3>s!'ރWs733΂1\}ڍA }J{9_]wh0Ӏ}RdqO~և 3wĸ[Rf.oޮOB|AۜQ9B{O^3=$6TqwcoOFccGwF;<2=|F|$C>|RKW䧠l4 n/@8ҽ~#8os+ޘ~)BT:!Hr<=XOty{l1|I<>sΞo93akQwҷzr̲?xOHQV?Dճ>; qw{3*k wd nזT K!cM Xw](MNؼ|vNSڈ qHl)xOM;kt}&nȗ5B+#̘Fö̡ɧ\w_#T o olzhGZ՚k-'R4*O- gȸxӋ@.\E\mZ~ wZ٫~3=(Ө2p&HO<Cx^4̋?C-D;u^Vrҙ]MT gˬ|c4b {&;|@ 7oc#x|t \c?IV߳L7wH0JQ=$S~S~kRc4BOM~?h6_1'M%B@ Lst}Z2XR?os@ϣk>`&&XOAx`z3 N=~@ V]$4/1EEutK>lR~3C塾Wk&q_}΂~|ܝϵ1>mGSCc>ϭe>/^8NoGh'FkO!G]ޓVSPB.".:ʗ?!]$z5y+]~#K.xŁG{doG'zdq9SēoA+OCęgAOt.ts>Fō ٿVpE>gfF.;i>BA8'JOkC߆\h-@)?J_L7Ww> mNx`kz(!HE c*8ѱT q'1{1ލHbwX#}΂\WǾ#>R}^\!GsBX[~)y%@+xSCt\}yސ @7@m? i^\ln?eÜj Gu7LS}!}*{]$z9Cc,x':i<߶>$e9NOG7|b|0G;|~bGi[=9Yi'${+j8x5:=MTmW`ZA8a EU"m2ݩesp+QrR%!Q8mRdf@114'v;u[Iڼ^Q&̙'.g<0 We^dK,[ԇoɩ˔E\/*FLL4ܛM~nx\^9GIS [3? าZ(uJ,zSvTI,Dz;Gy8@Dnݙ7pLk;Lۮ.e#I{*ȯXVߨ1xLv,nryCN:6&9 Cw=(Tl DѶZ:븲Fi5Badchʞ@zbNӕTi9 %.:H͘?y.u7.==kV"v67{+ ާ[ Z3TvOSՓKNz@~|:3@ a?ú v__l21GI;c- h9H̳x̞v9.7{.7{*vU#.IӼ]t爮`W_)UWg^%󫠀Ys>z;}!HW|.~,P n;7w֠ n?;ׇĖ ׬Uɯ:H{jec"~?1g$E>#>O>$/HpT9H|t~`ez8aTѹ=^$.tȍ?xwLq'2F9C|}\s! y*nrw{^ ~W1%bS/y]MG_)?/J9hw{t}oU,9?YK;__U? ƣe~1:UgE[rw>VFKOA$>e8A{M;?o\Om-Ʊdx1%(%=*.bz#@:ZW|@,;8Xw@!FryGI2Lj}a\I_|lHtsn)ɜG}# Zs'pFӗ8.eƟr}G&0n!QWHXEd7KUeu$>EM*yϒG?C:tyw~qMk?Ty/]_t?ǨC,Wyh{hy40.2ȕ~r.[֭}NlѡQٝh؈K hR盜QQg\S\Zr^17S6S1) SLzͳoI,Կ7,-fmb+JdU&Rk7$ϢӣR@w&yGSX$Kdot~l,M6e!e[޲g\Y&nTs5xu ^֢A!O>ΤdžOMh盌K#!j:m jZG*H}pڶjU-ϓv-}"c3㾯B̷#GCվsK4ڴZYScm^̶6fȹUT&'(rt9z;}!HW|.~,P n;7w֠ n?;ׇĖ ׬Uɯ:H{jec"~?1g$E>#>O>$/HpT9H|t~`ez8aTѹ=^$.tȍ?xw,'eǖq)!\E][(b&&ţY@g=ҝ{] >#>osHh_wbx?I@^O ߮w\IA5o1H>s! y*nrw{,w%swb =ga%G'ٔ1,L]_䣗H֎>|wGn_ϫÛ3>_ho5Zj6Ws_}_%7'sEo OAdxOFYqO!.xӳFQ5A>FߒLkO!G]ޓRSPB.".:ʗ?!]$z5y+]~#K.xŁG{doG'zdq9SēoA+OCęgAOt.ts>Fō ٿVpE>gfF.;i>BA8'JOkC߆\h-@)?J_L7Ww> mNx`kz(!HE c*8ѱT q'1{1ލHbwX#}΂\WǾ#>R}^\!GsBX[~)y%@+xSCt\}yސ @7@m? i^\ln?eÜj Gu7LS}!}*{]$z9Cc,x':i<߶>$e9NOG7|b|0G;|~bGi[=9Yi'${+j8x5zu]ܶB6˾KwEz۪^\ہNQdԴ%01ۓ2tѴ(?w -/Nq}6vw0:̵66]؎B_KpPX$,^6wh[fm8ԆLYc]֖1>b5E.RϽn VkrJMjsHs-\M`'IEhHY E:ŨAlfx,!s$.c.iZΣV*tJżklO#^v+ۣoJX:<ɤmTWFi{ Mc hctYg6ҳrՇL1&M%:JZ#u}}/_v>MұTozy2~+r|LWsQK6eolϘgceWi =o:.M9-2XE] T"Ii˨ܫЋRGuq%>$f_v! :V+/ zUK&^DXVlJf;ĕBVEƽ:Lgt[ky&$SWE>񯜒g%1V6ɜ:K=dz-YZ݅BP#"1y|0Gn%>֘RQ렗3Eɠ1R KRyy163sNkȡJ鵲[FqHq M26ϬFѢ3RP*?劽̸rMδO&z$Rh-Hq(Bdh>ZKmҚЭJkȋRvyq7%ILmCH)hzGBԕ 4wm<>-d7RP0>,EΟΣ\xmqUR ޲~}4WS\W_zqNLKh"}j5KgԊ)ɱ-ZU{̽N2Whv¯6fIx-]|Faz wn82Jڂm+Qubʓu5z:m|"6e_p,mh䜓nwoiY&MV]s Q!k84Kvi}^[I:FpOzۺW挷7ܛVkĺ[1\ڵSNOmS%)K6͵s֦!,!d+v[+o2HVo{ңX)y A}\eLcIsT2<Ӧ +:Z#۶;i3鯻SAS<3QҭԖ0MW{VC6&<5ib\6;#ugNХ?>DZ9H)d)Nf6oy,mif1iFG YWm\^˚r܃KhA܄Sf:R%LWqe&>s[ *'\Wk'_PQV\:ug1kQbs3m -^%ͪ\}MgJ>,zMՒׅRQ Hf+Oi MD':Mߛ0.-&^8?7hkc!gLSVɗb֩뵼ʼaF-\Męsf:R%C{uoNf }-a[e;:Uk2Ӧ>HM^BD6wNflRɋJ5)L!ԥZUsGB|1Tm+νpƮΩȇ51C67eOYzSO?dm턴߇Bps1PU!2bkTWaz]Tk b'Qg4е!ꅞ2~r1ݭwøq)g" uɶ5qefG,ѫJUK1SƐ꣚$BzN6O 6 uJd51mbHiLѫJT&Ki1&4U'C1Ye{ſ.m")]]B\ &Xel b˫6/u*RC潴7[a4MΙ_NIrUhW=Vjԭ 55D&.$ۗdV[[)5˛Pxs*Q.UA[o'ke|#Kv-k\AiIUBPkң¨Ͽ&B5ܔ<-.۝_SYV5ُ5n0olK#\QjShrTju{ޕVjԳi&мG{'po^'ydCkđή]YeҠQ>vn@+~w- -Y^t+?ppDz~c:I(/|G}柀|H_cБbr8$qäM%B@ LsryˠQ1/pFq1t olz6?*xm1~):Hcs1x?l!I}Ξg}7׾HÕ%ؿv 8(H!GIh{7|K%'i^='m `E$)~׾os3CleGz6< $>f?z&<{ѩ1wz NoCk#gOKx=9wK o/$H~>JznϣO1{ ++@-9̾s\hF2逊w/C{]"G#sߘ |e$M'ē̾>3>S8Fy/O+/q\#?uEcM[??`GwC<)Mچ:͘}Vq.SfԞ\WjL&9j3mN0A4n4ԙƨ{Yv4Wb[Z})B&qT UQp6ntMmKǺ<͉cMrEfA5!3{KF "ܴj{2N(vVY;A3tx"^UM’(): Wp:%yQq$6֤dtXƔ/Vxv:)X c&Ɣ[}qPV$(چMIFl-KW~4vu#ycb@LPl\oiP,k:r])4bاɘpa y0f!Ԧ1&3@,^KZ 諾tvٲhtz$(OYx?}&qm~Qb䫋^;| e%\z-TD.:]bB6'%8AL)_Q5A&wi1.Qm8Mj_u{uWe{Jn):"n6:ژm:f~?= \q/w5.]X_"6FYz~YWe^{!CcN!FWU&mjt+Q֩:Pա69eÐQUGǥp 6j6uLvou1_Z+gfLZThHͦU˦TaROY)+ouHV#|=u\EAj R)zQUO@ͩy-uTGQ217G/Ym]h*WjYNF22>5$^*ܷyJI4g7j6Jyr2qN2bI{7/Yڠdj[Qm-aLv2Bz07mdُQ*LƎ9LgQ[-z\ٽ[t]ftx4zLu\@-5l$xіP楻WZjMd_}Ⱦ-Emrnizn"uJ+jX%ddĒan 6.vzqΗϚ%R:ѭS!TSj#$B*4Ku %*7yhDpN|Ù/+.k~|&\MG*z\IJq ̔]Ĥeϥm)E2/12uZ915ѥW!Sjld&YĦt-)%h>[w~zxϗӜ]S>zTaTӬb#4B*4KuJջI;걢m:[& -ūۋxv1,CsYm3%U>܉p EEEÕ7vֈϽ{\ZfU]# `z3~YWTuyxv൓jd DA]|:< Jgrea;׫,L:nn-4_|IzVzXDnUyOiQ(7i K. oֆ35[V-Ӭv-,5s9+'lzmC L"˝r3kDiE/YzPYkoD^<ս>bۯ.?L1v CyRm*\v׍-0s7Bq>Q ~8/8f,m!V.9qrE;b.:TiۮsTe)Y ZևŒo^Zb֮sdI2mM5ۖR=vvW.?P`ȑBr℄K6A)kKj(NO>-lꮭEK t鉮+Q7{R- Tɖץ)PT=MuЇq>I73}$i(SQ%b;ҁ1Mn<T'TTɵ8DN:E>PiҮ-0MlYD˷&}Fښmȼ ą8DN8ETׅn=hk#뺃lUk*BrM}] :)lAtkI8ɑ-d]udr^2wYhNyV"lozcߝk\o#޹h^uNUlmN/EQ%Hr2&xe?>]`|hM[0{a|_ ?/ŋ䣤bH´|VfYü IA7J~XGDCꠣS6 %7@eTRr[AJ%%V$7J)7Zz㡡[qtXE$%*\BZQLRIw`mm*5xH#)Qhn&Vl^vrl7bBr5EfRKMov9SIS$f?ݢa-ѺHi14Rd3!^zX|Ė܋djmLFQ[ɧɀ)43hb^$vMri3j]N:nI2|\ץYmIfFʬYLn|2C>q`u!4;5#HLwmtWUz.&CgډW1ԸiWbuQ@f;4BƴJE:'-XJsdk cdxSwOI(s;Gj\cm/VsӔ7viPyppU6}tȯ¶Nf}]NnG*ķm6}k6-#Ԧ\tdpzG5,N25^z%6,v)ϿiPڭ(XOf%fJ6yiOe,Pj%R^6\+7˱,InUR{.3Ӡ5!TKe'ٖ]KYuC{-&iƕ{{~ " Y?+/m[Xؕ|10R5NUi'gehK i{S5┼Bzúߖp%X6kܻ W62|,s>w}ע4LÂN/4sI ׾9IѤj.E]Mn0o՞6#ozFPc{n,,niUIT.E_nMw,]Ldsَ? lz2#,$+_JxVCIU*j *ޢ R1D58 m }"]f!Ma"IZ5d8ua.ƠҮoj.Ι#@LS\BѧPޞ鸆i*[I8֎ wd>*t'sMZa aV o;kKobТ~䥚#R]uxERY.bMZ"Ԏ% tULnZlz] u"E8O<۰R*ݳPͶ*02wVjOWb&vͧc]S. 1\ՊܗTTn\MbZ;#!%n/ C~y%KSnY&͚z)UUS7ϭκUJJz*-7-Ԗ/m?['{fOLJ}]2vVT> vjPk- {nߛk;!vn@+~w- -Y^t+?ppDz~c:I(/|G}柀|H_cБbr8#j1БSF~f5 c"Xdcgf;^ {2!w뻝o$y&2y"Avv.rI w.+ˤmJ>/Hq+C98$u bU/y]MG_)?/J9hw{t}oU,9?YK;__U? ƣe~1:UgE[rw>VFKOA$>e8A{M;?o\Om-Ʊdx1%(%=*.bz#@:ZW|@,;8Xw@!FryGI)sAj8K~>JznϣO1{ ++@-9̾s\hF2逊w/C{]"G#sߘ |e$M'ē̾>3>S8Fy/O+/q\#?uEcM[??`GwC<A`{6eӐXԛLYk8f:YqU z'T'J9̇Dw@4d-|75A}ik["|T)]l2TKBbɋǫHXS'ζ^,< o 'LS=H_cqtKFC*,Jv*]56S8 N2twVطj~4U:\fvYޮaI~鶭s^5QU:5+֫űG6ވ6 7up͑RſQ֞ыplDӮL{3Urd;#Wu ' g[+Θ͝*b:)-kR7+6 q['ˋ;]zuiNoeʚӮgܗ{׬FQvzg5k*oLkvVR`kW4oյ1A.O {;ίdV"ZY1!%ZF5+)f|%tEH=XyULxlNڶmJX03ޓOKC^I.a7fM4_kuݟl=3|+=w&cq\v=F:UcVZM<0Z̛r_W z5ݦW 06*}eaw&ɗ c_Fm]4.zB*,d@ :ԓzKmHc.]NtAa&Q(ޣb@%o"ӱ=JYP2ͮK(1Jj35o&*N<š;»tE-Gf;>T3g<&p}{WAs.f" \h?*T`Ĥo }ihKGW ZY$-7mLeM=YeOz>~DBn59+i)ƄdCB:u I&ָ,z6OvFf]S;߷V/mUS*/*Py"Q%0!-&FBxMs_vk)*RPr#ɍ&:ړl)LmI[N*#BWMcW?!iPV\;1Qnr\p\q JQTuJsjTj fua!DiVܴ%]cTY[u2==EBS2zUhQ+ӧ8N~=RMrIRitKL(rΩ2&(*+v= "$OrϡN2q/:{Ĥ9-ZzjL:*93.sV.yԪ:Y;NW"Ip&^rm?+Əv۪~_NXc2XRRķn&)U#'Q%T- SΩ#Iu+%lC2 @U-+B"ȴXiV;L˽)Ь*dDf"#{-zў:_uF8cKlP&A;NѪHm&Zb"/:|+)CƊÏ3V[콐,ɧS4a0|ߏlG#c9:m+P XuYmn6Z58ۙFV'D[-NYvMY,xGb˻, KQd‰ ;e=ꋑ/Tn _Xw}vd|'gӎX3uykC? ںn g`[U+U:u:mfMre"Bɩ$n<8)[M-~pㄱf'[C ۩]RӮI{rT2k).MIY#ulCҕKdc.%n2%U&lKnlR%߉&&&2"zToL[h#Z \H"ç3IxhU;b`wlc;JzͥTnڍԦKKШ]]hR- z@xG-ʽv]ڰy{ɡLNB?PEi1.b)KLm1)HzC]s:6@M*]wj+)j&PvY*B_PEi3.b)KLm1)HzC]s. ]˙nTnoe^\ˉt#"JmMm9)(ma<xuiBXKCX~Ԯ^׵ּ͕US~uQkmmͣnjff<6 OV3mM˺fyȴ710ɕňqT 9)VhLԒ&|_˒m:f"Y91 -du*kÚ\juKb^~\6Ͳ54FSّ&(y"pдlޏtABԴndjz4uh5%4YSI#д$֧<"V6ѦF;;a,rjhTad-1 fTǕL/hrIvv^#ނw~6Iő]*=cf ҿgz>j5OmC wOק3䟨|>i"h~EC2~l ?EOB>{?\3{\wdG2}.$xeGqy<|6{FE@Q4M=r]>. Lirw4?g( N QD7|G;_st\=pxE_s͇ 7 K8 !ԿƯg we7(_{6gr: \J.zy$Ɓ* w]?ٍ̣aee}۽?Fq;= >t|7}_~ٟE,RfC| LQ*3"- q;j+| b} #%ď䧠|}Z2ˊ}_ qw{&7ڎѮO' c6cXF2}bϭމ%jG]ރt=>Dj8hG%=7Egѧt|ƕ _|l9Ʈnw_{^E;Hҡ׽. G9>2Lj}a\I_|lHtsn)ɜG}# Zs'pFӗ8.eƟr}G&0n!QWHŬnژc6/;.eR3b^3TU3"Q8rb3ZmQ4#3]9yn@ Ε3d)|]oӸaI֍5bJ=T{܋!'=DzTl7ULoV|W-q<Ԫ p޴5[vH]wT٧ȕ%n-/eWBu_56>壯HO[SRw@cձ<;hufeFxXIf=:.}IB6bϚWHw~-ɸ)XhVԆ$ŕF&Szb_z<:iVb\]vP|eb|o[OJ~}5?w+^fV2+x!;Oba|95H7W0I%҂Iq.l`0i an֮-k:bcrߙqdBv"%L[2e4-o9iS:eՊ*ܗ wD BwϯX*u]U-fŠSb:RQM"TZس 7FBݳ[GU[Hɺ V;vĸ,3̥tR1NN6pV.ꔺ<'f!;).(&[QfaRBcqytu}6^kYޟ2F8<1>Ԫ]3M$S"QYvL~:pda{Hqer_ugJFUPoWpO^Yf-4Z\@R]}o+hE~".!Bŗvͩt*c{mA*56c4Do,\?>R&6(\tl bE}9vPt7,~".gZ cx vQ2;y>e+E{Fc|U cxv(M5_sc$x~M=i ~g`tJSt >e%B-rsQsl=V/ppxE#[=@c'z7Kj}pn^?Ip_scY d|}џxt!\rGNl2g<2f7R#^?Kr*.< ޫY}sfKv- 򿦫\863Fctqo[ʯר2z*i'^'ϞG_-d)jcYcߕzz"zߪz^wߝG[gX֘%7"ZO-Dg*PPƘ&Dl/}sm[UC߇*}{}y=k# Yc2(jM\:|n d: |ӠNdjT94E–̈ZVF̌^*]BZ.lJ2 5BQfd "S#J\mԤ- %$̌d.uF}ya^iiqZq--qh[kATW)F@Tթr)JeB;rTi8Y&yKSn6RLr۔ڭܨH ROЦ`E~ԷD꟨By/4-[Fe.iRT>%ndW/)On}W}0۞i)jؔ)өj0cjIsˎI(8z kiWQ 3=FcޖulmRۿvFKq]TIN]2+$N[&e]IBT)BRjRd)-R{D\&;)(J%BMJR%JRa%)"f|BIOYFDDf{i kChS)(m Rֵ!$jR%)JKi 1R:wp1ix^e&r)JƑpH8Kt(WQvr{ n #Smq1hA&vʞ\k^&XR*n(9#5Ԟe-|D(rv5QnB߫Ej@rn * |H$#civF麨ӅBSñ1]aƷcVؖɺgIVWI ;ꧣW|BGE7Erm)l)rSGӘR^SFA)ŤJ"2t[6Ut7 Ҷh̦M^⹪ NȩU"ధB nEi|d)sS"SO^D>i&mQm2!M^7-.jƳ^/.ٶhQ*^JK\-PZҝLC !\Ch3A­ەhD4wjTHnҮbHthߴwMu[Q7:2O)NG2+̼ڐ&GBj 7gS&Ĩx6fA̸zQ":iJ2[&2}Ʒ귞*챮J5lYƓ}z6KZSknOa.MQ̡թmȗ tj1.*1VG^i2#ฃ>Ȍt{ػ;tScΕK~n,TdIaН^eJ'Wb8:۬[N!mZzͭ+NIEIm# N/k/JDZ,_\tՊ[bI~u\Ȭi#Ľ7gfFo.;i§T rߥ'L.4 x٥{Pba'w05Nttbq^yעI ][*8ј=QFx1;oAO+ c)>o 1AH棏!,m<+xSCt\}yސ @7@m? i^\ln?eÜj Gu7LS}!}*{]$z9Cc,x':i<߶>$e9NOG7|b|0G;|~bGi[=9Yi'${+j8x5XƏ>1 1 ׾ l`1XJ:H.1ߋoL+Go@&e;$mĞd(8vi[wi[SO@ )wzL @6+$dOFfgڮMyGP/?'+G1^=?غSX~*}>Mo=@kjv􍁗LD؂:ElcmG«?5 [#q#B<Kn :v!#'Gpl".b_{xH>N;q8s|FEdz?EꥫjLA.".)*$~8@hYI;}Uq[ݽLۜ 6[@G+Dh|m.~{>$F>3rr}>_>S1K\m/1{Q0kC+!sҶ8$緱PhkMK|v_qIL&x.'QkGsC7@΃zg͙TX\|U/h|7q_5+B^ZHcUތ15ς̩Pi"h["w|ϚdW[jz׶L x)f/Zϗ&?%U2ߔ? |=}k~C_W^{yβǖ//qnJR@/T/7_{ߚ~J"V0mk.Gf۵w-%vӷJ,+D:)r">9UbPdTzUWJz32̗9ȴVDZKjv cn[EgK[4IguIWAq9u[+׹,ˢ^ٻ5bHzN_ȥUn6GQ1hիsY7]5ůxիVIzVpd+E%~bu:[/aT{ eʫJ]TXșKӦRQ@Fr$uLw{v|VJou{Rcָl/ꕫbˡW2ڐiSe}S#<{w`zÔ Qwz#^tzuϸ)M*_x;\LqS)o'[ ͑,+ob+t8ܷ$qѨ{~*pݽsI&n۪y2q*iӽqQl}Yi]puԤUTaÇOꌵVSq4N QOXܝ+L;-l0E2-$ݵ;vP(4^r]Uwg=!|2}cfz>ʫR&Mzdx\,ZZD[)\yś/fL;\ݳzwXߵ &5[DW Zn*ĉh)$L-R[Im< tPhœǦIȠR%ԜuڄkU[f8IzLSJkSuV}N/]:)1P2uW[%LuVW U򧶙Rі̇}p͙sd!Wvpݥ8sSnOpw*lʮ9D|yFAi5)}C|tȎo*V!Jݻ+x ͹bJJqFjH8BKn*kIU/m;X[ֽՑpERPȷM63X|=%Mӷvihq.YmD8֠) Bf!I=ed3ȉ"*,VLwPy&eiJm^mD&iRL`ĝFc%Dde~ZDde𑑏T%ĨD>`̸͎Sb<ܘIm/GC*[2#ed-iZL4HF{=i%Ƃ4xu~wz~ L6wΎN?k7zP!2K~@}Z3J=ԏ'u7!5}A{3' &(>"}q;%'|>JznϣO1{ ++@-9̾s\hF2逊w/C{]"G#sߘ |e$M'ē̾>3>S8Fy/O+/q\#?uEcM[??`GwC<~|:3@ a?ú v__l21GI;c- h9H̳x̞v9.7{.7{*vU#.IӼ]t爮`W_)UWg^%󫠀Ys>z;}!HW|.~,P n;7w֠ n?;ׇĖ ׬Uɯ:H{jec"~?1g$E>#>G ?[X~*{$>LrYy7Ϩc`e;8A 7'sFk0^G/e(ٳBqdv xv<[=Td>D6v23Kb\ZQB=Nw۳"B6Pqv6B.;xKxp F{jq jjOi +hl_U}( Yme6|$]Zv}pF[pc]G̏i|}Gd6 soc|9xv'b9Nq>%/RQ2 FDלp@_G{WnQkòOdq7>t_sCZ8G>tK>lR~3C塾Wk&q_}΂*VC|it䛑d5nͮlKNLT8樔RVUm`םIl=CM?({kb.wԙQl]VUK D#J򤶝UN[piɼ#j%&H/|1[H:m͚͓~"H?HQmjc[EI]yN۰XEg,f-AAϯ*lZqܲXe@SQiRa&Q$u{㻧PX{2U:F[l{&)O 6Ik)]`Ϫҕʥq_N $$"e@5p!L$ 9; _VŶjLgހQrcU rLا&֠*֤ӐYQu_H>ZMGWt=D#Ѧ**ZLQNר֥E EpϮd\#m\ hc$KJR˶M܍&]~޹(VmQ %iO(n]=oATE]v;S9z\vsn\t2.V1iօҚ^팹62Ö=-k#1氵CΘNy$]>7.%$S4ꈨmєk3HYHLZϯ*XfV~M6S*ՈVqRt*7m{֛dSwCq PzQM9GmZWǭr5RԨ;-Me[m#COoSPpLj ΃x͜B$|d hri1@K*nSSkI/ΥK"?Jۑl YwzwrnzM]ʑn֬LLrf{.Neys#m&&Զ6Wm=^y:^:؝N]zBZS%ԓ$u:L16o|fWwdAӗ.̡W.JK|]M2I諭ӤqrgebeBwUYyBWmURQrTFgOlt44U$#f]XIY5c5/x^jv>KUjN*2fw؄e⎆onh; ޹ػus1ZL>![UBvcӔӰ\r6ʛ뎶T|ᆷks)7thb{ߓ-;=z6Pt4zͿ*_řLŝ];NxV5"z7 zi˚¦PcVǞoj}W-+J`Gi~F:v:8t;5Ǒ 55Jr) 53>!)Ay9Q=Z5vZ/,j2T:UmVTҥɤ!YeX6^ӎJVWtXE:ݤz1tDrD:7TI`{Y%TjXJAC+M. BZަ4}D]`Q/LQ~X*1t+f+b?ΏBiJ@n=Q=W㬓}Tz5- &"oj,XG|jJ˼(!$E* z9eձ#0\"B{] [ݱq=9g d]9צDլ yvߟ2Ly<YĺmHr!3AtB>m\Vv5jܰnTEV!IZ<-ʎ! 4u?8J.=m]RN3r.bkHjD:ֵN}&F}9tA_I4FdҔ[+:a0T-s4C_<\S-.;K1Z)B+ZؔKJqUjG(vk7B7Thc*z:^y~.uXTiu]H~IEi&ֆJo\.Ev]pչpK΋DLSM::f>LFI"$i6tuVwjγn#%Ҕ;ib;U1˖̙iQ4%nFcGs]eJuԓK*mً6Pڨ I[)Ԋ~,h]zJ zS=Lj.;prDpʹNlma=\)&6o2ٷJJWmyAZB?6K>oP\>M5v!.9O6]ESɨ"Uv"2^s?MK9Dm s5yT5d)%)2эj^U] JaTpӱ&D1;6O':[6|m=fk@LdN^L\)xNF㲕_mBj 5uU84 E0b<@ߥ'L.4 x٥{Pba'w05Nttbq^yעI ][*8ј=QFx1;oAO+ c)>o 1AH棏!,m<+xSCt\}yސ @7@m? i^\ln?eÜj Gu7LS}!}*{]$z9Cc,x':i<߶>$e9NOG7|b|0G;|~bGi[=9Yi'${+j8x5XƏ>1 1 ׾ l`1XJ:H.1ߋoL+Go@&e;$mĞd 'nq#]o]oTqwG]ޓP x\)jg( R\KWAw'}#u; wCkđή]YeҠQ>vn@+~w- -Y^t+?ppDz~c:I(/|G}8}4*sH.i{|k,"G͛6 Ee#R6"/`#l  $.>..Y>wLq[x[8y&]TK[ZY=dG"۰l^lwHM{:iY=%$jlbR%U;OG)vzTHJ$\<o7sfԤKone.go\."36au0(p>^>3u;B\s ">m[@FW&=dF~hEKYyxvp8|}}%Hډgv9T8c,ܞ"^ގ>јW~A J-x쒋:<߶Ύ3|]Yv#HGmD{+ɳ)vcq'28E[w_?0>qP֎>|qwGn_ϫÛ3>_ho5Zj6WsWJV&g`+ Q~.}~SDE&]TOy%I:mJ&iIϺqÚ57mYw5ThZljr3Y=~b\Vb\HU&[ː}R mi8[fwIq"54/"5H~iSD쏇^"_GϵMVh? Uf\ӫٖTEIaVڜe#$:YѬLQlӵJ6tUk.S>-څS[ b4($`Ӧ,j"Պ<Ǭh k9o:^쒊I.JRCiJ )"!'FLJKQc-Sduy(8j݄E64=5hCt=\ktqg5I7Cnۢc ]m $t c*3M XE*p;=dg[[S)(O-QfK ZOW bmC)Ͷ q 4?ZKy6UI"̨.n%\"u´-ޑm]X50RJSfyy,ԇ|)Q5<UqE S.⫱1oOzDM>C.Gkt)'bOy]..\"}-*81ŷ.|؟ kuߺkb^4.,cɛ[qu~ۚtՁXRzkub]u_*>ʉ>޷.낽KU^mq%;T0ۑCkWut{knm5NqKʖR)ڬNc ꩧTӏ%M+<_invS,]tԨ_d+&}TM.lz4+5*j4uؔNuY)ՆKQ>Qt\?]JAQ&?>_2Wl_J?4isZ?!MjI>oT_HU^\n-:Z[uPIIK#xӎҖ,\fVFm|Sp%V|3zW.;GT8UkK}n ("I_;?Y҉eX4omsC|#Uyܛ1~ZQ9礼l[$ؒ"C,S^tGm蚶~3t.xyE^= `ȹ+ 6rhk؆}\TRעCGr.6f| '"-dB2mJ+^誛]o*2ڷ)QFXD](ȋiNzjcU^(TJlt6S~483.if(\k'._n0Ƕ5.KhB95Zvdd&[8z2Im3"&xQ8̸Fd]z7Tvս^~]j[uG`<1quria\Yr{i*UjT& jZ=v%[}( ~̙,EAme3f1jȑVh~U:Uf-CEIȫu<ŀ: ?'yW=ꂌr矨&}o*2kC$Lmqkxׯcj(? MyLrq钗Md۩WFŒO#p-YNUUFsM+Ҽۻ٘a1е$]M#\-7s&U,vNEܖJݐ>׸Un4Kv*ظ wi򈌛yF[4ͪXx-r FЋC\txk6sETvHV$۵5ĨÐdl2C2-+w#9zL5=Z :Q*\4EM-^:MQ= |iZ2ne6PؐʥBND᪡j\Z]k\kUt#&Qxl׊51z.kVo,))mĻ4GD&۳m`HwӴr7/`Yu.^@ɴZqqBr#]Z]JBD%͗Aԃm]S$KEH6HZqJG)PmUkv+|b\D44+U^6rĹ.þhE+ݱQvEp;ߣU.3t*3SLb( ~,%0g)o?a`$zHڦopަopNq=*x05wr**,ľut 7rxy'7^^#ނ/^'y6Iő]*=cf ҿgz>j5OmC wOק3䟨|>fX=dl{ <1M۽F}v6Qzquaͥ>N1PG>.t̆n)u {6d{{`'8,qp"=N hTȐuRde{9xԚuS9I=$F([K÷ |m\\=Cpe+*lrS#ǗS.]h~Pqf˪eͳf?l[D.qvKghr4l=knJum2-G;ƠF">m{:G m=B-_u"4?m#ڔ9l <4H>F\!>{v~وgmD[NnJnaaf]l_GX7cMGl^YOޭܮ>֓* hw{t} oU,9?YK;__U? ƣe~1:UgE[rw>VFKOA$>e8A{M;?o\Om-Ʊdx1%(%=*.bz#@:ZW|@,;8Xw@!FryGI"}q;%'|>JznϣO1{ ++@-9̾s\hF2逊w/C{]"G#sߘ |e$M'ē̾>3>S8Fy/O+/q\#?uEcM[??`GwC<˺&Mz"xfzuNCs+R-qʬ"-ItЩPl7TqCWyw1w~im,7_TPpj&)ԤO\ AW kWXyյ}GѦnyt,ml%P6Ld*ՁB5NHMs91PƉ&'-ϝcfwo4ХRp^8;_U*K0曧Z5Kzcvӕy^&%Md48՜{>%hN^܌I_ӝaU:tbͦg&W2BO@$V-ҥ|#t'J225 eYw]ZդZu6ݵ ;jVg[)Щ.ZՔ-)QbiOldgdev ZָV;BEaodU%C~b,6IN [OΎ%Ved=pڹe0}*jTǬۂijRG,m>OV-mޚ쥑ɨ,MwDծ.ݡ%W2/:=rķV7iԎu75 h5\Z[ШPT1P,ݕvfԩ -X夬MI.M北kt\V~L"+6D2nU7ٷ!ZQ-m) Yv-ne|=Egj^Y7U ެ] .۠SV'ƪM% m&Mķ\Vxu?+ʮN-[*÷\ĵ6kudST'PÐM6/:v˅dVjiRvF9W"r.+~2ȠN8) Q'ũu#<<, MܣLVR58g9ږ;(QGǷ%aTޣKZ݇MUsIiJ&L9 U*4*]KڶX-r Ň-]L*::-VLUHS{x-<÷Gۙ.LSY.)/UzDtQ(2( qR\"YՙK_owgXqͣ+\11#Xd ;R &Ezum.$KJ2<w۩YYoطbSKIݥ ЂZI Y2r7ڸܣ|!g bLsE74+~EҩR/9`ʳMC:QnY LE:߆dmJ4d*mT#Xv_)KcTn7\1䪵S#^qV8~BffSUE4Ye(wҮ8R[GXrDl\1Er"$Otu^43\yLڸRcV.<͸ªՁJEkTrܥ#"B# f MQGQ>̦+ɶfVUj YMO؎ S2W‘OYC˗1VM *"kz4Jn-R5\ifqԘ ^0~|:3@ a?ú v__l21GI;c- h9H̳xx$c@.7{.7{*vU#.IӼ]t爮`W_)UWg^%󫠀Ys>z;}!HW|.~,P n;7w֠ n?;ׇĖ ׬Uɯ:H{jec"~?1g$E>#>"]mNaqkgA`7-퍁i8<S|%{8G~¸(ˮ&[ð;6$ȹ6 d(g$-ڴkc!IC>'nͼOa?l߇e||\f;+./-:% x|)ٷa {gRdIO}AJ1~hRisgrm uKjtV܉pro1`8i?is>k3iQqlG{-n]U_x9O6Bb\D2={ehvՈGmGU.s-[ π?hC̅Q%!I[vqqlc;DBR$D{R^C\[ ǖWLB,_gF03DZ%3M\bt}u'*ށY?#- p?/?p{Z8H>tK>lR~3C塾Wk&q_}΂~|ܝϵ1>mGSCc>ϭe>/^8NoGh'~K1_?o>1)wzLIJ'oO|B5 ~*^t )u.t"ig=냭|BOO4>I nf/g:)>/c/#7f[?ٚra ><)?~fqyĤ+0<]}0߽]ޟ 9;ၬs#.fzHmFǒ߾!P1ğg֌Dǒz5#.Acx:w ry_Pd{IxIg"G5} cm?_#O3^jiDnJJ cqs/6W7xZ;ѽ̯z`"y PHy#c>I.i$/6Ϥbw:z9{#>Fz9K{8J@2O>#GXVp7Q(Ǥx;ښӆ^: ds̸[U<%D ߖöEa)DpnԡvsS.\UGm'ɎBMY:v4_jR&V)wiYfbe*,;(v9 zT*n\{GV,bb 3_yMtWm[vZ*"B$S}T㸄wfhYZC&M0w~|ױpClmL(BD*rjg-!=|#1 [s~0m*jKv"LyF;kq(woʠ$‡)B:.j@F5c͇)$lJmB݋lYH!51R rDPriUa]4ט"#hZ S}EgXEnC,YcGh6 po},_%$ŏ@& 22:L|T}IT߭߭'T&tNwC"R_~PW_xήfO$Fw@#%1#]!>˥@39g|Z3aW_^Z@2Z'#^3W&W#S~uP^#/H$"9mpvxHݦ,,nNڏMF6EL<.D|e[6{8Lo6"N۳gWo V}p.B2eK=Ƹ)gbe9Kn0.߸IoD\Kam0s8yJ[fI%'xpݜ}l>ዱM;\-n!Jd/M*I%]|m U5ty3wg'?TV,^% ] y7JzmǴ˷g.nvU8]➪*G=^#JȜٳo/'?F8;˵&9vW ]d\b7M.}ӑ[vl2{6#Bv{nd!lr}Vz{Q+apm쎽s\;} r-tϯȣ>B#dzƑrl$(ˁ\>3˕8E>%3۳d+/Ҽ{xM?co;$חGc<+m 6{5!l]AW*,e.*c4>ZMVpl/g!WAokQ[oC>i.$%=;8і\SHn!4fvry?POѷS6HswĔz6T#PˈWIj^J_@/1`o/As޸:G}$ ~T$cJStb&~C]&1K=ϲQ1cz6oᕳOY|+KpPC9ғn wcZg??4s,4=}5lgu] z@QnhyS#Ƈȸ̺nb38"EVm"1u5pӘtgA\0#{ Dsxӹ.SToԥ5R+:vp93Kqը&Xx"\Pf vbA#(8baДI VyY*@ƌ1TS-2irbW)Z暞y5Ԧ _ g5{5qDZo 2賣^Sؖy˪Q!񛨳̷ۚVuXljWemFI&l1sE A<Dq4#\x潬LqXv}s"n[ LG+6 ƟKU4A0l5ԵIZ^W59];PX׽_m*ctEPS WJSMGV]1Q*מpv*.Yk[rzE5>cS-~ A fP6<ɋd]iQ.Gih9V,A|AgOUKԶxzÜF+{RmHm*ct .s TJ*iJeyh4ߚ}>&U* :e.5>Mf |L480aCqCM(m $^0aS!Caŧөc vB #H8aДI $XcA<(P8,HK1FPe!IJHSz| M&:]*-:LEb>O#Bd5$8Km4RВJH0r sC,YcGh6 po},_%$ŏ@& 22:L|T}IT߭߭'T&tNwC"R_~PW_xήfO$Fw@#%1#]!>˥@39g|Z3aW_^Z@2Z'#V3W&W]#S~5O#˯J)dvl۳l 9v8:6t)a1VEh|2W6hv/!\{_&džE3>Qv{[ .bA6d|^{ ssѻI][R}d~ EINy̏-.=1!7R%pm\|[6oB"Iym\w{Kh)J~ų|#23/p8GEk{*f O?z׺ 'T둑x ٟ10lH(giEDevz'SҢW݈G\6OUZJv.^.ѤZK%%Ϻ ]Se혲=JKu{:ŷr."q.|}mgu|~7!s| q/}ӳ6݄\VFKOA$>e8A{M;?o\Om-Ʊdx1%(%=*.bz#@:ZW|@,;8Xw@!FryGI"}q;%'|>JznϣO1{ ++@-9̾s\hF2逊w/C{]"G#sߘ |e$M'ē̾>3>S8Fy/O+/q\#?uEcM[??`GwC<~|:3@ a?ú v__l21GI;c- h9H̳xx$c@.7{.7{*vU#.IӼ]t爮`W_)UWg^%󫠀Ys>z;}!HW|.~,P n;7w֠ n?;ׇĖ լUɫ:H{jec"v1h$E>#>lȼ"2l.&=Fd[ &\ٴl Sl\im-\Kv-{G"к['f-/Kd  8z-!"-w"-\Go䤋AK\>]VJJ \_^i?kc";>iv8=2P/Mi3 v"̺6U$\ aw#a-;6(χ? i쪃#g|<2 ܆FxEʹ;F{^jA&TImðh }d{<.g*{p-o#%iYĮlχ丗>it2g"轒]Vpgriu.d| 3.1u{v{'|\^.m."/F;*RX߿A߰c8D?^ݻtϷ/ ֎>|axn_ϫÛ3>_ho5Zj6Ws_}_%7'sEo OAdxOFYqO!.xӳFQ5A>FߒLkO!G]ޓRSPB.".:ʗ?!]$z5y+]~#K.xŁG{doG'zdq9SēoA+OCęgAOt.ts>Fō ٿVpE>gfF.;i>BA8'JOkC߆\h-@)?J_L7Ww> mNx`kz(!HE c*8ѱT q'1{1ލHc6iնrf=;H\:Tx2%IYtKkM6UBs Fm^ 5J*1u#ȵ FXMl3V]3JNUoƫUBd[,.67)N.EUh\G9rCze!;Qlԟ<*Θ])7ik35tEfKz@#Gbexr-]ɇ^V&.txUS(8׫.jrTIJ}qcn&ˍ|Z:|Pܺ:LUoy]ZT5~u!CXt6+͋@z:NQmM.nfڅǛZ(kjOV5-uK*0sK\ԨzEZjnh1u?=Ti_}ԭ[-e{ pV0\uʍ"jkxܽko"b^fjw\n RУQb9]T,XθUKk*=ֱݵ|_vMjw|^mqvhQ7^\?BI(S& ܦW'!Ɉ!]T6{6{HF9{N7{u9cakU﹪ rEQhdK#ף/~mb;}NmFOviy6=S\űZi4j\Muz=UZ+ػ0RFд;%{H˨=-lw\V׾lm@ڵZNԋF+[zj) QԺoQ-diuG~񮧬j/>e:ANCoäUjӪ SBӷmؒ4[6pn&7L\w,oK&[Bokj1kKUn!fu$e4 DeFj:oz~}ˢ}+ἇYė&;Vm"qU"nZ)1ƤW] m='VL(q9Pz̺+'kr΢VQeŶ^ȉ{fU%Gq>{NSIRP.W԰f&9}O56[jkڭ)jEj0/a,2JeIo^x׶] .x) n/s5 dK+ u#;3bLoݒ\ɴ#&:Jۯ-1M0mü %^9v̶o $y4Y Yi]ue:dBL)ENKzDfdyz ԦQ=D|rNM.: 2R~%U1JicXb*2 Zi6J+T v; z2=&24h޽4e4jurDHA6Go ZUW"j g*&Yy2LMW>$-;?*.?YSKN?>MaІnTZ7rU5Ed3fT뚵4*gPhRRrv8θٟ>%9 _V^j9S0E 25uo!e֬;fפMYU:zy֌"֍N/g_uݐܞf)D*̧eҡÎ1M B l9}iyf権]t+VθeЪ3[DjD^E̩^uc>I<߶4y{>3>S8Fy/O+/q\#?uEcM[??`GwC<~|:3@ a?ú v__l1? [!& 62:L|T}IT߭߭'T&tNwC"R_~PW_xήfO$Fw@#]&$uwB.͞w|Mj͆_~x|Iih Z5_]t O_;'kևN_?x>c(jUCmٳl>.ТQxKR"cfvl">Bq%ݛ8{vEۤ_iIa #">ls "A.F= OMIN[89:9ThTpqgC_v$*蹅tk-6 sgk)ϳm'elYm^oO,v_Ⱦ *˭l)I6E!$|f^ϲWQlٗOܮڈJ#Yp@r 462)|{6,wt2j#.=NF^ܸۛK֓_B?kj8Q ##`m)k/oP]u,isg{̹7n5V؟#1;緬\+۷njTkGsC/ cޫY}sfKv- 򿦫\863FctϠ5}7h4co?I}h.)q|7Qv3j;F<'ݏ[bQ|9KbJQ=~J{*Ue\YRG+tOF%~YKwsq7wCL9\l#>?*xm1~):Hcs1x?l!I}Ξg}7׾HÕ%ؿv 8(H!GIh{7|K%'i^='m `E$)~׾os3CleGz6< $>f?z&<{ѩ1wz AAMy(I:^rS.zZgdm:Pq]DVM5R!ؔ RWY*اϵM2zȹELޫD|\OmYhqj7p4~-uYr̨7j]W![uyeUҡ۔ By%QDϑ-3Ƣ7,[ٯ?}TYZ 3oMMOTCA"&μ]I +um=EeZXVIL.=wρLɧQ(6.Po*-g!#I!L\mnܵC¿.h۝nH <\ ̘d5q]i]R$whKV\^sB9:eܵQJ-ZI4@ngTɹ"(Km7 S6j=ou{_"*.*Mgk6OvnZfrcɚ-:H_R nTBZU\ozͩke]w%"/:%^;zqU{ӹ=.KOo7%}K@JQFKemM>YjQ'ZTIZyG.I_mqOcgFֶDf7ij/V/Z2\]wP<5mwsR^sUvmI6皖S'tg9R-8h72`ܕVLm>ݝtY񮪃ѤeZT_=c%ݮԴJʎM"f%L[n:.k˚ԇB]'c@J˳Yz뇩[Z(6IiVU4|Q&jf[L,VUX'* -S7lbM)UCPn3c469n-U^y4kjGY )Տxrpq\~#q-%*mJzP,^1ڦIq !i*-wnD!3YLw aPuC'*Jka(&fWꖥ(rgP)eq65dMyrϺ vnsY7tETalVnl^["imFJgOG7|bL>cyg&'pFӗ8.eƟr}G&0n!QWHXe?>]`|hM[0wݠ@0ݾ/{ď'c@ h9Hͳxx$c@.7{.7{*vU#.IӼ]t爮`W_)UWg^%ܞ#I:F;wL7Iő]*=cf ҿgz>e!H_zT[4MV*]):ٓ-l<%$|$6i.mm8Df[PM -jLXPP)VukZ[{eUr;Sk No܋!dKIgiJބtЫl E1*]0|woy|3z{G9|V[fͿ}7&"`"/gVݜW]{QN=fJnja*]0sI l;ޟuOJw}iޭh_+UZu#`u&aq2_4D=t{`2k_?"܏xPi4[^ Q=tO\ֿmlܟ_'\_nǺT?퀿:@0??pD=m[Kխ "ҷP0-ɴnǺTl/wޟԬ+s3Vjԏa{t\v%|Q=t⹠-='gOUZu#`9H#a\'^uO Ӣ|kF{6#>E[R?t̽߆yǺTer1#=N3uڔ+Պj2f'2C$jr+fJ"%Wa2>}:ܥRL-5S]EMEZ̶e7O[KZJ-(.˗tLW8Zĥ%Ii#fGI"!8w: 꿥W߇6gQ` )p}Tgk+ja8l>A K}\nNڊzaHv6#)!1ğg֌G/zCu] g7k}%/ѷ̟zC&$ѷ䧾V\E]?@u/D~BHKTjWG|:|]yxz4ގO3>s!'ރWs733΂1\}ڍA }J{9_]wh0Ӏ}RdqO~և 3wĸ[Rf.oޮOB|AۜQ9B{O^3=$6TqwcoOFccGwŷ3Dwru,8VuTkOM꣔ e+]T&o͛g3wT#/c@_k`^:y}vrRK Ӷͻ^~S7CMkfk3w3.VohBUKBzN[}-*Z{ͩE}d$ޗ!yGZYn˵)Jv +2 Ejx76EVzε.yz'H+2f rF]1`v=cm¹HfTz$cTPڧӔ&Ru*Y5 [+(f{gxk8Pt f R9n4v-\FʥGf:ಆ_';Gy/Kݷ/zV26k1TO. b7ɃFkaշ^ٗPwߓUN"mdUTR"ߊW/6'1T޺&~η-͖e6[:뒧09hz-x>RǚVi a2UNW⻎w|Wv̕J6u(ZSxyu?SVߟ1l{ ^Wm$OnUXhgqIFF YԎr?sٔMXt7hq;Dfd&A3$6!X6(6-MЬ|mg[6 DejjYXVJiהnH2Tb:z9{q11j3_'pFӗ8.eƟr}G&0n!QWHXe?>]`|hM;>s&a|_ ?/Ox-ǐ[r gC @Q&H"y]./kZ)_IPQ>vn@+~w- -;!(Z\毚\Y㺑4m>#8ͻM'dD}@v)d ٴ({;^w6}@Ui'};Y/[y@8NډI˟fx@pDr.;{@:i6$}M|:YVS~vP~t@$ϋ M$]p VMpy@OmԨj\_]j4yXԋ)rjvzH΃zg͙TX\|U/h|7q_5+B>/@ކ'}2]HJzwq', ސGwBi#|~v?oo5Gm'ސ#.I)Dm)FUs@eK=e.%΁_wb^#ނ 27pu8H@Iƕ!LE'Lb:z9edbl+g"wҳ3^#Wb?4T rߥ'L.4 x٥{Pba'w05Nttbq^yעI ][*8ј=QFx1;oAO+ c)>o 1AH棏!,m<+xSCt\}yސ @7@m? i^\ln?eÜj Gu7LS}!}*{]$z9Cc,x':i<߶>$e9NOG7|b|0G;|~bGi[=9Yi'${+j8x5XƏ>1 1 W>"l`1jR^T-C>J bZ>+~R3l$s'H|w= #ox䧤]gP}w|H.C\]tNwC"R?\JU|U9@Y'tvn@+~w- -;!(Z\毚\Y.cHsK]Y#w{%|(#0ڇM%06G#$>qvKѦQI]R6m=+Ht"2-r{ mGr~hBżG~`*&-ԙ_[vsn7c`m<'B"?лq;|[8zOnT|o<MDGw6sl3R}]b8 ` N}J.g0J$/t-^I%x<[y9vpq EpB$%|?S0 ^m=&Nu5YR/9> u=]Zԋ)m z^ޫY}sfKv- 򿦫\863FctϠ5}7h4co?I}h.)q|7Qv3j;F<'ݏ[bQ|9KbJQ=~J{*Ue\YRG+tOF%~YKwsq7wCL9\l#>?*xm1~):Hcs1x?l!I}Ξg}7׾HÕ%ؿv 8(H!GIh{7|K%'i^='m `E$)~׾os3CleGz6< $>f?z&<{ѩ1wz NoCk#gOLP|D99wKoO1 "|)FbP O%wWW7|[s}~e{E#_J^pD3G0#IO/w1sO'}|g}#&q1-j3_؟VN_Gu>蚶~3t.xyE^= `EMާx.[KNoM)#jmkYuzA^T:26E~ͻRǫ[!re?* cotՊx۶jol_+U>)BZoqPXkNxe}Cާ\d8\Tʄ( CNv"e,SyRUmŕKռx?L#mj>;I]zI^.SEf۩㕭ÐI]GbO0^ksZ:E˵Xϒm5yT:^ܪG- =Rm< M8ZTҵGwѲb+O݅RՆͨ%>NE5*-)=_iK4[r)~Vn/ ߀V)b[<w.t}[Zte_G|1׭B~Ic?6\,)S5jU9>p )=R{O^{ŷY;׆vfdadvMIh4mZ5&Eל#LžHqPD`L5}xoIYKo,q<+ʋnrZ62% ޼#^)'8(n*11ZYmjRm׋1R, *VE~B ەŗVAJ,%GU[Me6lb} i j&XT-} aT  CE[moMk6"9sӴr鴪|(}sc?..M&b32 evw\u>cm$ ^F)Yi5m5w;?Z>dNHSjwMjӰu1gNOkϭ'%!)ͦ@̸e?>]`|hM;>s&a|_ ?/ďLw1=&-5]6?d_E[r"VTxҝ0j~ywgPUMqwoO0 m;W@ xJTQv~ N?`,ľcg.SL#ek3W^__(|K  <ίgT~lkPlJkKHK@dd5p>9#'V@y }wh6c]d|~ oC%8;pqVۄJ$pv9M#$x%ðѩd; FEsh Ovv fݝ\j9xQvx;9ϲMz>-4B>F\49F-}N͝v]S{]&QȒ{|e%`:9b"WQJQ+;} (Z$J{&GKy ˄-5~I'<|;9Hϴ\sݾ>.IKOfuzlWwYK=_MxuipҰ_ϫÛ3>_ho5Zj6Ws_}_%7'sEo OAdxOFYqO!.xӳFQ5A>FߒLkO!G]ޓRSPB.".:ʗ?!]$z5y+]~#K.xŁG{doG'zdq9SēoA+OCęgAOt.ts>Fō ٿVpE>gfF.;i>BA8'JOkC߆\h-@)?J_L7Ww> mNx`kz(!HE c*8ѱT q'1{1ލHbwX#}΂\WǾ#>R}b'ȑGsBX~"yW䧠L4 n/@8ҽ~#8os+ޘ~)BT:!Hr<=XOty{l1|I<>sΞo93akQwҷzr̲?xOHQV?Dճ>; qw{3*kz2Ϥ}:Ơs@ș9-t75Y3B\R#l!לKHRkKܧDNϹgL:־~gr-|.qn g[zk6^}rx^%otőpSP]2+z;R٠[Iʝ]YG%aZ3Q]=ݣ{2N~v[xv7et_q݇g؈t&4fjLyĺ)rn07M;>+Q!į]Պ$Tm | ȼ"Td m![9ZmϚ.eyWY/}be $\UCU$ -TSUOkiPQuۣ㣬I}ۓ.|(S&X͔2T]ú>kvf'KM$XMQCs:j5K ܷT?D2u'Cj Q51!8bu~kz[sי5#~$+@|1l̇LHۇ!ش-Բ)}vBn=WW{`PF/'g&fczYS"SVY{#Fί˱[uj6EJTrCVBZ.uJEcDS:ƥ)JQ){r`i**+W:͙W~QB) Ҕ3'@\R[Rfj1 1 W>"l`1OAŦ; ^ķEmL<%vc}w6 #nԣ^ M>st L=l {gvLZ߈~ l;$C"RU36{[> F"Y!(@Y }?J|V@FK7cb9G} =̢6͞w|Mj͞_~x|Iih Y̟5YF'5|%K}d}.0Blfh( GlEMr'o` YkEMv=~ .2]T'\;=&RI;6 %3'Lm[ ;~ٴ]eE+۷۴"?mJ2vlOM'g]a+b{<[ -|--bDJW2J\8Y[$OtXꓜ[x[K6 lKtJn-]f0kuZvj^i@zQޫY}sfKv- 򿦫\863FctϠ5}7h4co?I}h.)q|7Qv3j;F<'Ս/O5Gm'ސ#.I+Dm)FUs@eK=e.%΁_wb^#ނ 27pu8H@Iƕ!LE'Lb:z9edbl+g"wҳ3^#Wb?4T rߥ'L.4 x٥{Pba'w05Nttbq^yעI ][*8ј=QFx1;oAO+ c)>o 1AH棏!,m<+xSCt\}yސ @7@m? i^\ln?eÜj Gu7LS}!}*{]$z9Cc,x':i<߶>$e9NOG7|b|0G;|~bGi[=9Yi'${+j8x5 +%TH4f$)i5*}SR mGD) *TH4fI5*JA$|dF[{$?Tȕ5$$im+%M)pҢBZRD)q4;sLN1lNF T ?Q*]f[E츯EQSӑVmIgkJ7W3`\^l NLnVyUZzEOɌwiqmD }x+Dø)갥z{Wa*uU?۾M\a1͎Qms?/YSrܗMQ1NB!ue--)OͭOCV.޹^vr||^5x=t&uXf[ԙldhb+qjlLǔ5!yHZ̗/j=ˉQ-=t קz 2͝ )j jIuZ]\ɪ=yW"˳Q\Ԍ-9dU\Q7ud/Kv uw&ڱ\(r"I.+Ka<{f+8i9EKYm̈́G-DJ[w%tKތ}Fu4U%=5emMڲѮQNJҦ#]ym_8隋-jݾ,ڹ~̂,Bv^mʟzFE4am0cy ~iVm:V&JpKfWnzq1YU TҔHƘ4giOON fZͦڐ*u?4U:ܦ!jrY$ZCCdMǍ("IC4u Ez^VR*3!`,ebLqLfqnlJXmJKiJ $R,_w gˬ|c4b{<|D 6߇cİ}b1'l/ZEL{8љ`$U~ 6]VR[F7p\"d@6=|m?NHUbW_TU=Y௶/}0nW?[cnOwa?he໳^p=k^C ?] hwSlkPmJkKHK@dd5p>9#'V@y9ӵ-ppl}ElmK|SpZڌmKg..rvKEk=` oEMr8 J2쀼4[I<'=]C[ o/WРU;wsl"b"#g?@)"ح` b(%};[jB"_g>-nl_ds0>D8;=Nb.x>>0gb]2ퟸ.ެK!w`XԻg3jP+uylK@z-0΃zg͙TX\|U/h|7q_5+B>/@ކ'}2]HJzwq', ސGwBi#|~V7ߐڍbQ|9KbJ=~J{*Ue\YRG+tOF%~YKwsq7wCL9\l#>?*xm1~):Hcs1x?l!I}Ξg}7׾HÕ%ؿv 8(H!GIh{7|K%'i^='m `E$)~׾os3CleGz6< $>f?z&<{ѩ1wz NoCk#gOLP|D99wKoO1 "|)FbP O%wWW7|[s}~e{E#_J^pD3G0#IO/w1sO'}|g}#&q1-j3_؟VN_Gu>蚶~3t.xyE^= `!,u1όu4f @y-nϼ }__l/lx tf=Q}͝ %3/cƹ6O s.t#8>?@.14E{8vv9yVQ^/pV;;D|=99@8r[ǐg=eQeYr6jlBw~Y\.~.C0j_gp:|=]VĻ~Qd}@!B=]4{6j57;5%%2|goC2|d? KK h h-v:Hv@L=k#&8rv9;|@$#ap2?oFO"Qp$q{6p( pP"THv`;E=;{xv. ΀OvuvsqwOo~ Za'ðGؗ8;'\\fW9\~>#av%BuD~ˣhzb^/LE+Ὁxoo Z/?Ox|uiT@_ϫÛ3>_ho5Zj6Ws_}_%7'sEo OAdxOFYqO!.xӳFQ5A>o!6Hswĕz6T#PˈWIj^J_@/1`o/As޸:G}$ ~T$cJStb&~C]&1K=ϲQ1cz6oᕳOY|+KpPC9ғn wcZg??4s,4=}5lgu] z@cPިڼo]xf_~b]}`Sy; tZ%.\r.JJZm$v;YKvrNjvĤW4͟tZWQF. %9.5ԗfJJK!qYFqYoG74v#*MFcSIW4i[DbAΤPK<#{>KyBKӥR՘4+6U[^姤U.#s6"T=9 44^ ~|:3@ 7}aOú-nϼ }__l.,%lC?a1Oձ,v<s/ sk}[@HJ<} o<]Vxr{E`.)<~( I<;x8OuHPGnkI3'o/c)ꟹuF[xOɰU{W'Vx*"쀴 8xp{\,ͼ;{^G+{Rq@#U^|ϷBU/\q~djwSp閯w{kPftdz?j!>j\ϿNjՐRq|{S"2#;;&Ehٍ-lx=Fh.B&]&@/Eprqf|p!v?`.&Hpql6p#$ko ^`~%vy2?!ꟸਸ਼)RgjUYW>ς2>.7S{gfNsx'?{%\]%_Iؗ}݀/oΥWw|sjKf*?4׎?@H>tK>lR~3C塾Wk&q_}΂~|ܝϵ1>mGSCc>ϭe>/^8NoGh'F~kO!G]ޓVSPB.".:ʗ?!]$z5y+]~#K.xŁG{doG'zdq9SēoA+OCęgAOt.ts>Fō ٿVpE>gfF.;i>BA8'JOkC߆\h-@)?J_L7Ww> mNx`kz(!HE c*8ѱT q'1{1ލHbwX#}΂\WǾ#>R}b'ȑGsBX~"yW䧠L4 n/@8ҽ~#8os+ޘ~)BT:!Hr<=XOty{l1|I<>sΞo93akQwҷzr̲?xOHQV?Dճ>; qw{3*k֏*X5r-<_xҝՕ}\ve[Ya,*s;\oͩ&%F@-@EjN\j.oZ1v piJJi lZnm$m!=SUV ?uaJT~u_MylFOѰ.zr''&SYZq"Yh,{WOZۺ.Gh'U4b>dV,͍DuJyjM[ΰ|q,5O.iL>gjթjnQjUheZץCʽnYzjN3]`|hM޾wa|w>63{6wb~^3; ]j\-7c\=28vql2mur^B8 J+x{] +hȸx{$[{;?[=7. 2aɔDG÷JWgjCp GpHWgYIu\>>^vF6Gwiv},.p6rloKefu/Wٻ'@gtX޼~%dPZfOWisir?udx`#v[L5> =I{[6ZKh\K[h-.NzFԷv-?' v^3eap$T0 8 a9KaopC[}KhYue fl. GSp/gݛ8?P6[A K}\nNڊzaHv6#)!1ğg֌G/zCu] g7k}X#~C?j5Fhu}LswĔ4v@TCP WIj^J_@/1`o/As޸:G}$ ~T$cJStb&~C]&1K=ϲQ1cz6oᕳOY|+KpPC9ғn wcZg??4s,4=}5lgu] z@ټS.fvMg7Buj[hÓ%MuUiHRL8%ȍj|w:SsVbi9jv6Ԯ^yG5Wn"[T5Q[`R" uf}s!67鞗uTŨzP~rt^&DaGϦПOJ&iSqFg2xwnBb\ɭ\u]vERtyY?]&\KaKZ2HTmEz۳SJ{e|^ "L[OnT6)h3Bq\O܉x]}q|]snwajpQUζ>k5uM?o6:wW m*NWT:ó\Sʓ|Q=U }q.땆c Y;9a)@X|RrR?u3{w+79[1vNUޟ1{^K5QV)(+|8,8^ҋ!+a݊֍q"~?&;E W,ޮ5T_:L94է!EXzZjGQuJe%ӻ ˜z>:š״2mj3)}LUPR[k\w,ɓm.FzZ9QFjn'6^wf2]wePYuRw-ݍAz&ryU7hF֭3.x;8_Rۂ2scMs[ZUFv8\ͽEvFmbQ[H`*i=Tv"J8x/ nĠ @.6y'pm/kզT<=gdcT ap6p]Zl-yl~{|%pd aWgϱ&[sqmGT瑒FJx~!ud=^m%{=- , 'j]{K'x{`"Y/݂dP]%s IU~v.P#år-&2goC2|d? KK <ږ~Ǽ]Kq= &EcvQx v6 c|LtQ-^plTt >s`/F{\T{tIпPh=P.~S{;ĹPIuW[6`#^ V}>NԻEoH}ɵE7l'˱3ywc~vu/ToT~i/0zDޫY}sfKv- 򿦫\863Fct)8\nNڊܢii/$%=;8іlSHn!4fvry?POogFh"~ swĔ4#ސ jaq1tT -Sѫ_ R\Ew{, ; #9?gu8H@IsCJStb&~C]&1M=ϲQ1cz6oᕳOY|+KpPC9ғn wcZg??4s,4=}5lgu] z@Nr?/K3. K?)?IՐԏ;^?+PGܨJF=GH?I+`^;'w~`GN5>>t}0W4 r(6$yvz\v5 mn盧lvZ" v]4KV1dfmufaJ 1%h)* lccd]R:~XRp\b'&5rє Ko'ԽIVW}%6u"52XujD˕>N6mD.<]:u*ޚ.LK4e[vUnǧ@m |TT-"!-9>C6B5׮HX+մh‡P[RX2M&2+ЗRhu)Zg7'Mzn%?TCpn{icokS(iTտbTMu K.Ԡ<8AmV> bbfcleeY63*%ݷ˧b~l$q2RyZ֫տXssbkoB {|`Fѷ)th4JOHqr&Z%=!!)V!bxvcݳv8E&zCNdtlǝ[>J9 1&:SqNq-n[Rm[w)ddM `*S[8Zu9nV(:U'5+9U4rT9ϔNpiגYe:t6I}N7DɷESLxYVmY]$Uʷ5R,hpnjɒڦgF"pM8[HyؘJZ=&}CT-/26 &W:cpR+X"FW4z4_sݯJVrVzi/ lUYs4gKtL|BOeMglezM|fP1qW8 hP6.\,{4PKjiXb:~U''E19Jf;vr4C[ޱ*C#JWr睫W.#[MCj]J{UnRR j^FAO~|:3@76`0ѾHc!}__lbJ|K~$D` !nH..^ǰI{nq7lz## FIpl U"$_tT$ @LzVǬ'axf]>oo_>>ī%˃"FF}}|v;`8+=e.׶^=>JFmW q=@[jGi/5ʑ/w@Y a(D{xO撉 i={xv\|퀌Wd{y^dswQ~lUO{kPyH-7om 1;!(Z\毚\YK}I]|F9ӳ jZ.l{޲Ki5ME{] Gl؟w/Us{GPw}n◒] 994>I觗j)z@Zx*\D~#ꬶr{_ho5Zj6Ws[}_rw>VQ4co?I}h>)q|7Qv3j;F<'Ս73Xo?c9KbJPyHD5 ~*^t )u+K`/1`o/D@!Gr~[#Ϥʾ$w;JStb&~C]&1M=ϲQ1cz6oᕳOY|+KpPC9ғn wcZg??4s,4=}5lgu] z@jLw=rrŝT5ZrSbjiOOJM$-řYG1WcZ'ekZ]U%FU*^c *LԥƠ!n,ȈJ>W7XֳOXֳ-⻫xs-/7}r$w ANp|G,y~="zZw#+ˢvZ_EF\?l_*[7m6ިuڵmOVCxZ?ʕÑ(?[q۟ j/gU~(+b#6cՖ]eQOW7KzW ,p[Z_c-qBs_$yCs⶧u EsNm2f$Zf鵮U|UW(wsu+FrXb}gd} J)'Z\nhk+en;rSKzt"}1s`2ּۢi)2y*>*|"fl `b[%/ QϱZe}3(U*mJ591q[#)>*|"irOVNXĕZxS9P1xٗy'ҪzRxkz#5eiҺ.x[m@ aUm7CuD(*jRb%&W5h J_-VtCrn(*2) "`êw[zru 5)1R&˙SUUzJVQ43齎ӣڐ. (qǾ c|E(؂쫺w7p͸3X>>%WQO8V\vz; %T2jR 4QFKWh|^.J5דF@"sVXOs2{Cq.F;vqٌdi|'2]5K?KXԮZő1-Z2P;^2*DԉUWdƃ/i8 qXY mԮT$=|5ɔU&,!iJim%%ŖXZs+5 kڔ{>: ]r]2QIө0Mc0٫ .}0~0ƚ1NX7ҫ^iUA))*-GWz;o9FT3KH.e EsNm2f$Zf鵮U|UW(wsu+FrXb}gd} J)'ZZ]nhk+en;rSKzt"}1s`2ּۢi)2y*>*|"K1 -֨u -2 * WθRI>d7{4WwrmWexʬbJͭA[ӜSPlU=n)<ZAm.,:Nɸ"ؚ_vZLA51lWE-"ԭ>"#ii13Ze,uRHtۋϐ}fx5MIJ)ʶm;ziv^ȥb [4&3;ћhlJHb[ zX}fנ*EcgS`*R)h0RV]a h$JHҖ7,2UM}'ʤ97TvQT(t{Frڍ"ϦS ǁ0J:A$ffdgt=w^y&)'^3wasw$~/T֭Vb7!qbGj &Ҍđ33.]Ee\ k7ތY^S-Rl!ŏ . a33|ِiyC45KMڪ]7 J()&("Ă[LGUS{hTjjpdDUfٴF,8@ӚYUؒ3=fcGydj[x^Hvm[\ lY%6&OҥokԘu^p3 y!ECQ}0&,Mgm.ږEƐ+*-iʕh˞7,HzYzD#LHZ#%8֠5)h(` vݽMx.nH~ۢRdW ݹX;ZZYudQ8syVYzs'*؟B{oڶDɖ-G-m1~_~B:iUmDCPV[3vA=Z͹Hk'\1\m* $|p\O˅jKI QRoGiS7eqdK\04pS ĊD\6=O+jLS)edFrWYm%2{FuY;R]>yZ+5(p"GVZtȗP$*ֻ>OzCS'ZSk5Lse+o.tWt缿\mjqǼ.[73]rˁ4lރܤ8ZQLHײNmif/4[L 虔klc(ٗ$z}D.5R@buwV-Ku.Nyڧ=!!BL/ L\YԶ_f>2kb﹨{^.TI#4uܣtU# 交8/iFAs5P.C^B|?wD[ᗷ쀨ظHqO9q'gq3pea=q]#%x}>^#%xe˷oph X%u=0Z>/szĿ i7HvwX;OY.+>]rzwv6͆w|Ojfx|Kiɘ Y̟5YF'5|*x>`w璮".oF^^]Z/6 ^~i zDޫZ5qfKv,򿦯\85ctϣc\nNڊz8J= mGSCc>ϭg>/^8J?~Tvry?POΨ/ObcZg??4s,4=}5lgu] z@cyVP'cO@?toob_eL .߹$x5/jY,,  jWLJ-^%^zeԨ{:^ :P,18%1)Ɠ )[Jj ڵs&MǹNOUj=Y4H"UiE*̗JΥR$?W' [iG5ѥyjU3P~YwӮ/nʤoڄzqvu>tKIfRZ}H/}ỳ8uo+JϹeM*(YQZ0j"C,yuj"YRqHKb[&Mde9Nu5c󋷞?©ZKIOɄ.sZc4F2t5#!?#n8"Ȭv3 e%@tuތrJ~DFiu.ۜL&;lԎyW̧J+y"FL]jD4K$Bdz3PUY2]qI6L$l0Bu w_n8ռjPӜ7x"T^ZUDYF2x5#}>nE6rMdjO2ү'HMMtL‹ͭ5>Xa<$RExBJdFJ 6~ۭ.+ MAT:Lʪͭ@DoS$\UCU$ -TSUOkiPQuۣ㣬I>um>,MNM܇h.aIZQyqf \륈&Ғ,Enzx}x֨5Qn[U*u򁋢X:K(uLN Ltלi1}GvW̚?\T R[㘶fC|$mÐZMQR@Y}YI!|i(s#S31f)+,׍r=:aq-:arۗ7N{դZ%)_.(`:AՍ2^Du>51!לe'n9;x0s:bYrLYdf-]EfاQmEM&JhN8ږ%雫jv)̉ %ҭJ̙^5c("nHR(,ަS$)RIvP>U]\ombh:+<byjSQċMi צ;[ƘĵԒ''[&SGb;?u𭉘vکKfد4VZu>E[L^7JvQ :j[dM V6c-nKI귽ǐrL]9 9&ÛIGSE#}kgRA=vea?(%.Blԯ Qb..lR^#J:m}5bUYMy*Ӣ߶.Wif@ιf@’íRoa?$ͯa2OWnЦF\O:[0۟. @,e1r\lőwM%rQ$՘w>JJ:-o7E#UW:S"S@9s!+vuN-K:"۱)RqR(G9^{4~ߕIv}f̫ePab|ʄJ\ߠYT)N-QJ35A7Zd[*hN7>MVf$Ԧzdl )fːj~ThsuŚ JQofP4=2Ub}xþ,ʬ5JZGÖJb2}NMaCTRqR(GQ?dC,YcGhw {1?s^b4{1?yp~/ )Q\[ T m(uiuA'÷viuv9Hs $x~/s{$}ӓ{@*xJHͽ c]INϺ{wbH\<&`;vxOwhOK^p#zvzRrIx˷rLyߍd)2?0<*#~oꀥ\D?gw)P Dt/l@k$Woo{-ZK%xeiIYm.>~`8%E÷vx~vOjK(Zx|Kiɨ Y̟5YF'5|*cȐKz@M[+ѵ^FIop`C>Ie8Bzn!4mY2jH~A-?qXcΒ8]x1%g4}{IZ\E]?@uu?G*U|CX )vx+8X ѽ/c/BOG#ƕ!™G'Lb90dbl;kBwҳ3^#wbZTT rߥ'L.4 x٥{Pba'w05Nttbq^yעI ][*8ј=QFx1;oAO+ c)>o 1AH棏!,m<+xSCt\}yސ @7@m? i^\ln?eÜj Gu7LS}!}*{]$z9Cc,x':i<߶>$e9NOG7|b|0G;|~bGi[=9Yi'${+j8x5-tl,CA𥍑2W ;Hbc`\WаfMt)|ƥ=Ӫ{uTGo9:h/O:54^ e[c4c&:Y[y+lBG#0y~ O6Vǚ.̺  x17Iv4b⡹YsiQA4-wbJ~5|ISȪ{.XIL\y">HlJbTY95&m'֒0]LjZEZ_6ѳn4b:U~[T%K$¹`3RgGa S6?eKVl2&QPn#+bLn<.o[uf*t ilRjGuS '&o#Ҟb>p&cۂ^Y7gb̑wtzɅ.lU[vOR*07{sb8b0)ճ/[7#Zݶd]4+fWWEqej˝HӤmCqL4:?[z+{? -`'r]D?GVMg|-|>z^/]g3z^6˫ =௖Vj'꾽w4GCS9^soX]gv|ڮ޿? RS}s|oYoY8_JW'Lu/[c'MCKZw|SFޱA}{?ɗj+ρ/kw o?,M>1?yE~{nޢ87ݵ{i~wwﺾY* +/_5NyݻzC:PK/)?ܷ-=b%(7}Ny>x)9i3t_ɗ|Q7|> }O=ݽF4~j=L/@oZuZ_Qx 9mdzB5? XljŬm銧Lʛac"nc65]V0njU:xB1:nl{n0'Wh[5xi-q!Tf^2eҖn9bmGΟ?/bc5 uKf*˫TÑKIl6L*n6Hwo$4A-pJi+le*\jB-P÷EFVk+smRa㢠E2Ѯ%.10u'{r몈y]ڄx\!Fn1Œ2Z%[Ie{GQ:'?Ӗ%n{bV'˂븫3WM}Faڕb)j$ n4t&BK"Zfӵl-fp[֔i*zT6Yu9oTkWḛ˓S-D$-6ezZQ T޳1 ˕p۞5A3zbc$6Z,d JJ L\wlyfxu6TzÛh 5舷Շ5EL]BLDwKm3#"7cX_w^`91$;e̵mTQgUiP%6~z:[r˧f\ڵs,Bx_.ZhdJV>Q1NB!ue--)OͭOCV.޹^vr||^5x=t&uXf[ԙldhb+qjlLǔ5!yHZ̗/j=ˉQ-=t קz 2͝ )j jIuZ]\ɪ=yW"˳Q\Ԍ-9dU\Q7ud/Kv uw&ڱ\(r"I.+Ka<{f+8i9EKYm̈́G-DJ[w%tKތ}Fu4U%=5emMڲѮQNJҦ#]ym_8隋-jݾ,ڹ~̂,Bv^mʟzFE4am0cy ~iVm:V&JpKfWnzq1YU TҔHƘ4giOON fZͦڐ*u?4U:ܦ!jrY$ZCCdMǍ("IC4u Ez^VR*3!`,ebLqLfqnlJXmJKiJ $R,_w gˬ|c4a|W6g+ 1?wp~/qj& Je{<.ogdzpp;{yg̑kEE&:@s}vmwa@r"eI&@jz'T4 '~D>W~8˽  Rr#Dd<{x@us!Gzv8~q;!pK&|3)S&{~eG5ڇέ=RwKiɸ Y̟5YF'5|*cȐKz@M{((/@'%3䧠>%Ďr 'xϪĞn񀮢2O|G}:*}ޓT~]׼U:R\*#9n'>ހ߈t{x P ǻ'|]Z/6OxsiJͬË/E>_f5Z?l6Ws_Oq|kQ[c"s 2_OI}h>*qKwGwBhY$vry?POkѳ>kĂ9KbKPF*aU\WSb%W>ego{È.xŀ}>$x9ì{vH@ܨs4>I meډ{t2yKF)3n^{]R/plZ^ gm|yt.Vfk$a_O$$@{=i%Ƃ4xu~wz~ L6wΎN?k7zP!2K~@}Z3J=ԏ'u7!5}A{3' &(>"}q;%'|>JznϣO1{ ++@-9̾s\hF2逊w/C{]"G#sߘ |e$M'ē̾>3>S8Fy/O+/q\#?uEcM[??`GwC<{Y5FW*Yi9f\t9diFڊr~s^r^EjNP™"jdZ fjګ[6B!& Kn"Q2V;',-dBi c "rƟlM+a4wLQLz8LlZ9_ @ĹnmKfp5d‰!7}o7H|3jR6_ԮaqoLodxٸ)7 m^R1{ڴdG5WmuvQcyVP'cO@?toob_eL gˬ|c4bz RƸRLҮ[f]d=$K*2Nebȕ@(dF;&3uu4Gi &ԗx|_g@88jԜȣQɅ|P[#ů@syE򧓿_&`5|DUP ަey;]? 'lH/\_Y4TwO%.=vNdIn5@G(RQ.3@ujٍ2Los{UN-:穒\(@S.iTG]\i}wg5Rsr~c%eL[y 6=nRfLQR--|'`y]W N. s(0u JmZq͡<'.{6%U=m{dT@;!(Z\毚\YSx{9~4c}H fq3ΞSL~+~Qtv9ˠ^Wr`‘w> 7'+'|x0%G\0νʐ }ae@Dkđ̠$РvOkR:^m_K 9X_S`)p}Tgk/j`Xl>A x<5}An'l_Ti-*ؘd۷Eі\T -}#N=.ѮO' c^~/cg"-/1#m|TX sx1sWwi7ag˵{G|]z\>^ Ic{]"eSg=Ws6rQ}?Z1Irϓ6F-?3<:}+?50~ v7OK} y=R{Z4AnIW`xaz?u &nrw{X;DGI F'=z(\Qލ%|Bc>ϭމ%jG]ރt=>Dj8hG%=7Egѧt|ƕ _|l9Ʈnw_{^E;Hҡ׽. G9>2Lj}a\I_|lHtsn)ɜG}# Zs'pFӗ8.eƟr}G&0n!QWHX a^.YBrX*B薕>z9ܴ(r+sa"tWe‡Oek6Q!F@scyVP'cO@?toob_eL gˬ|c4bzmq!qߝoFy\)iH vCݼgvu!o[g!cf^  y@2ߴ#E]3>^>AJ>w6 I v8`u&9{^Pnwa{@vMirvTv >-7>Mɒ?R2B#aEZ}-z"#8MJUOv9tD^׻o%ldxp!Pz ͼEɳ\VZKmqy6p uWMo64r| n͝;4P.N~*{,?>TyWGȠI -Vv3'VCQ _4:ʦ8r$ifg='%3䧠F)-&ޤx/{'sꀮcr{?\s0 1)zLMP3/l*k.}ނ.F7ڀ Oi}?#} '|]Z/.OxsiJ >e6Hc3G/|UO X۾6WsSOq{^lvq;j+{q4cumn?1p{f;e]2ŊUE>i'7wճTDvT;Fg'݈ vTn D?{C.xmvdDj\5*h|)m\Ijgc'tG{[YmQ{EemKO}GXpDJ܃3sio7ҿ$19$]6zâh>qW΍ 8ݥл/s^ۓlrw8>AX'JOkC߆\h-@)?J_L7Ww> mNx`kz(!HE c*8ѱT q'1{1ލHbwX#}΂\WǾ#>R}b'ȑGsBX~"yW䧠L4 n/@8ҽ~#8os+ޘ~)BT:!Hr<=XOty{l1|I<>sΞo93akQwҷzr̲?xOHQV?Dճ>; qw{3*k溵͚WC XtavvN= s˾vU+lC[-(IdYOv6ҁ[sYCZZ}Q^tm=RD,[ګxW*76*iJh7S1#{u'tBV4wl'H 2lGpUʗfQƳ@'ǪӪPyƞ Zi{wٗR]zivm9wMUƴIIM*QTvs6j:;`_TS?zw'~B~BEO|a8G'k`+ _Yuiq~fݥɇ1f(Fߵ, #3ڷ&ޭ}d]>ۈTe% "(Y\;Rkwy=F-=1>-ǙrrN975<>CTlƒٴ Ŏf}7t˨]?7O'ޙ^o _x>jP/C0]ú]`|hM{xlKke"Kv O>cF[֒VH33N۰[Grlsm ze%Dmpl5C-'/ca -FEx=@9?@vaC풶m g[*"Iď.pˢN|Pk% %mdx9{$]BIx=N^ 9rZIl".=H@"%'op˺4^v[C;vw ~\\; 88xBNHؾ}3yN5ۣd]]w!v5I1x goC2|d? KK JzyGRV_X<ȷ;:zacLmiכo*mZ1R'ÖcX&le%ļ}Rj{Xz,w.7kabÔ,ǩoZef匩s\}I'ERXI)g%SV9,F[:Z֦4F/+Z]2yЍ,>Kjއohɲ#L|F?M#Xدw]6EN1bԶBWGʥOKuTa-XME2LP^(9-q{qeͩNbF3֗E}p[{w-5IUt࿊ܗ:-R2(#^mHsλT᳼CQvGwա264aηj؇ gV7gڭVrYx(0LZp{paQ{oL#u2 xvBUBХ^B#r{a#'\u\0㨍^4m욎tcXej[Ce;N Wro m!mmr{a#:.C +iO; w@Z!eTgտKQ-[.Mq)C)WR6J,g-k%:uvsfAΙjVpT*"mx [6лr&_T#vgB2}%v>nB׮zԶs;?NW~܇#?~ڔ+6-%2\)tbɭ2J(7O=eskGߣR~.fKJ`]RMJEص\.uRbƫyJ jK |,cV+ ڊexՍi[xHH*W-M7j9 C 6Vi0^Pё˷LUWzϳ16zQpWjZ0Z %;)K8_J>oҖ+3Qکæu*%i>$oip{2Jq)Rq.&kky*fG:eΩc5VJ.K/,,sf'9 AڵY%:M&pZcn)JӓD#R5뼙jޣּSdIA!&ҿF7ΧTߡhʭi̊rEܕNGUI Ahȃw;G,P[U{zKezFQ*abljB>d|$c,t ߺQ붵vr%ĬP*J=B*i=FCBCre:dY'P5*3E-m/Oa []{Qbܖe@ʐUbNf.$aLZ*L2[ iChq IQ '|]Zùu}R~9~=9g*ld ,g}N>p,k !Q})rP;j*.C$icHF7sbX-F񗷰wؗI*wb"pot|V{R2Rewh{|X?I2ڞQ$~xxrpls/gIsG'-h\<#pW=/goYpؕqg4?g++I> vbw'w#&=}s/wW Uoc|C{g|NlnIm۱*2y}dI"8{chNo_Y%? m ^^? m~Ͽ!$'@{=i%Ƃ4xu~wz~ L6wΎN?k7zP!2K~@}Z3J=ԏ'u7!5}A{3' &(>)7I>|D=_G%=7Egѧt|ƕ _|l9Ʈnw_{^E;Hҡ׽. G9>2Lj}a\I_|lHtsn)ɜG}# Zs'pFӗ8.eƟr}G&0n!QWHX o޵X[f='GЙVuETYTŸtS"OBfKqmJdg U=2^o;XWUX[SumXէ:N l'T.R>&ƶ 횬 TɓP\TmchUZ>1BgF猢b7>UN񗐧ɥFZGl%I) Qoru[F/#k H|7P<TީE#WUX|N iKjuq=;j'[z.Y:,8FX[$<?z_{v:kç/k*`[ |ߔ?&]a<n3/ߖO?L?l[?+_b? |so{Wz>c<fddiXywk xn\mizšV;dsdcT]zVPUBopӨ͕>\y)N- EMȺԶҶJLkKkklc9;kiLDwSjԘ9q *[XdZyh1[y$'SQ L-Ol9"E:%%4%^#d4Oƞ~v bϗX3g Pm$p'&݀'݉G륟-RN#<<%nd߀[86rax<Q-tP~o;bF^/3r Zddr{@s ]͇WEy8pdI2?[33. zm0[ݬJ7{ g?+?ݖ!.Sb f]6Rso?Q/Sɷom]-uIͤ\E> }hr|}n"-6r٧:uMj-b壋˼" =!Y̟5YF'5|*cȐKz@SueRѦom0oꛐ17x"%2A86ZDaeuJN4FjG[";⧎3raRo٩@*h{ŵ)&mhqR3i$<&<+ aK6kekvY\1QKڃn&JK̶,̱xgv쨮H5=*#2<ة1Lj0vUPӍɐXIԴTL=:tӾ3+9w;CNfEWBe[zu{\- ɸm^FTba^TGCh-4!vF4Ӧj rx/S.WU*V% Tģ@R^TnC>Lx`V4q5[2#y:vHתV=VRڨ\1ulR1kӷ>HHl}Aꂝ׵ vvjwNqO.~]d{oVj4&Bȁ N0]v_yDZhޥb;P&Fn;imIKI%Lo>G8JJWvbCZc1uݥaϨ][.zKwk&7!E:ҐzI kd Y$LIFe V)El;,GTnƎ‡+&ã*V$O%-H[x-{!Zїmd=#Vve͢]j웦znҩ5(Kn Xn{KvCk!ٺӗ-d-$ժV ǖm΢]n웦zoRUKj XnsKu`L]-ե+m> 6؁[m unP\Vf=N*:cOKSe*z$o[['і5-jnv6OnW,(6{Y7 ӐO6l̯]]YZV[>.)>DާW_u[ܩ VI?vF3sm_Kz5orkLP.͇iyW>p[!J1"\s{IڅXVL \Pͭݓ^iLU|͙WiUũLuոc["=C*^㶮û3--4Ѯ;]fz rH9w{x|96ͅ;o2#m22.o4,%[6Kg&ٴ|]{zز6">2#.C"B. nݛ;\esP|;;"O[ϗUass_]>R1.Tg H--gψoD?0 RuU|;O4,6vLQU_d=a˪dJ2tq~7tHQq0"FȌo7)vuk3C(9ʃ<)?~fqyĤ+0<]}0߽]ޟ 9;ၬs#.fzHmFǒ߾!P1ğg֌Dǒz5#.Acx:w ry_Pd{IxIzs'5} amI'OA ri/z@5_7|qz%swG9q-W0NR(,-4mť&}c"^m6Vzlm.iEnFxp#6dڻge+R)6Z%Qj#*3 3ֆRJxf^Ԟ<3gKWmYv@NծBaBYB3 IǛuvE^k쵩 e"E8ɾ]H%\[Қk#I;LTs #Ts6(#N؛-`Bs @F6aHa2ke) 9Q#pEIǵ]9 \+Y7c;*X&ڍs!ސPwi} +IH^fC-HohyZ]e]I-Zq8ۈQTFdd{H ;Dli8_,i!,u1όu4f SoT";+_67"Vp. _-uog?{@<ئ$ oFHr#JC.S@/ &vL:F]^2>3=d@&}6ߠl-T>tt)#G!l-%.񀥪jVd-E|6[=oxkh;r+ϐϋfr"_r3#4ު_؞nc9ݭI wxK5RCrvuO0ݑTsm־g׹.WR2  U Uj-.}sW.GN)(xJDH"nZPNafō-~jS Hk%~mԭ=b#=o+VTHKȒ5l:2V(ә}yJb%1ö{Qr ȳ2^\Qz[u@whV'xI|=dz[x&ƃwWu> cb];O\zxo~M LKGI>Y|*mÿ*C\U_̢.j3A_ U/ʷɍ:ŁG/F_U=Ɖo_ zWԤy56Ӆ];? gK>&kΗi/OyzY9in;]#P-FѰkݗۿuuݷfJ2UX -&#=lYˢL&8 {4^ұ*l]wܿ5 t޷J2q:iUcC(܈l!DVc^:*.s\t/:>F)ԛ*V˖J'l5RC/g!aon^5"[6KȖƍwHXڻ}s֞J-EjϏFNYMCBwBf[+"}5tMYrpmecҮ ֲwjTr )kH$+5:w+3nkx9v0cinۢj̑(+tU_VwCcWې(WK\vA%IYӫ_n6n{Zϻ+-q=*$ޮǸ &3j'vJDd5Wor>Sy3b<|^WK6:'qUIVv>`d(+4KR$R}ZUȭ0IY㒛wixqfT\9vauIE8mRHoPSW<!幵2wl7{ܶX#U \XfzRJ6qKC%W6Ou|ڤ 3і4bvty%Q݊-6 W6EިGmΣ85Ȩ܂h㻏[n.X3⯀D*,JBTXJD0ŽJʟG^RZf4H\^f{ PMr/IrҜ_pi+\RkѢШ*tm^ bT!yifJ2H\5Κl,SccYNlw3Yj@f PVdvpHpƍ DZl҆53%뢙rfk[.v;nޝZNFitBUB27'!j7Wr6iGU;sfZYD^}ϵ5kj։eY~5 ݷs  7VKA:26a*WiWtx;fḽCj{T5s6dBC#ɋlvTM j7Kn;~i)..xzv;|WUg2Jf1Pik/DvZJϬd!=R$s;v5ɢTZ& 1f1;pm:,VfYʭf5&OjjCuPSKݓԾja6]~w/{Hez%W{5mf{\_|U?QaoWW}F~plw co6Ws?D]dH.>p찃Vl$irw|)ؾQqHxvmGsꉓhJ"K\$e!ٶ{{F'}0px*ٷgh;tHZ}nB۳fI$8[[8y;.$9vqq ##-.)#%rw6lzauigziui͝U^_NŰlkPUR / l}n"8ݽp[OjH˰ed)$hg;\;Kٰut Oxx8L6@s/N E,ٷӷ1s/ga{lc6V܅fl-!\~׸ĥ澶N^^?᧐9ғn w蚶~3t.xyE^= `1۽97vn1*ӮDYt[`U2\Ͱ"t浊t 2~vD-5,ޘ݉v0ֆk_֦0sJzKҝå6"1M):97_ a锹eF9FJx Okdp6տn U\QԊL^r]:G[TM+uHnǴ iV xfN1\>reLU+~3Nچ.jUKQJ,dS ӑ7B!;3nۛ"W7ofEa^W~3o?9YzcTj{Ÿ`٪)I5=Cٛ.\w}:Z6 Ֆ/hqk?"HW6ܑ%N4-TvֲI+j/T7V~Ply>ѣhK?vˈD3~hD:]2k4)$uGaP:xlnW R}b\`]ZUJ(%Q%aԚqtz1,Ҏ)ڥj3V9Cүs&Oh޵yc }U Cdߨ3%"|%6^/niO=]1=!b je!zẅ́&QcK>Š@,7T}j2icgܛu8P[cvkf>܉Rطb;fժ-PLVUY-1}bC Kf }ǖN/"%jʘܫ2*n-",V#)uۄN%Da'SGP㈇KzClJZ%&`6tܯKd&۩0mUlWU7tͩD[T#) dFy!u[qYKF1605|-6"ɼPe0.Ln[vF2n\tUS+2a8 p>96 V-Pzպ1ìj vUKvV\ęFSiWy\AƜ[kB3z֮ }>+2M.x7mpj2)vRNă]c) &$ɌJmu[qX[ QM#hSP>VjG=մlKRm&| ?&9mxw8 e |>ii*OϹǮvmTm͑sóƨMNP!R8E6syШ5)#|oG$ݹaDY*ZujסN&[U&&JGO ?Z] Tu!xH1B΀Az^ KNΰ- Q[44^(g}_δuΧ7i.Fz UiއcuKJ|K5UȖ{8DSM>eɇs$6RRNo##o 5* \c3[ɊV#Zc"EE0ӷ(Ò2>}6ˁ]-OZT#[+>lDsX*vA`OWMZw"ѳl SJ:Iȓ*0RrG*{'ST&U1u]I7wB!7Oڞ"ݯjZHV֛s;"E.|G@("\n [zBv) xk>R]ߞPBEB"dg]J^)lBVE=qk$̺ %!t;U+Xmeid(Rh&[up:uʥktiFĔ)IlSiBP &0e?>]`|hMl|@_ֵ+`<,ۂ4n]{~#0r<0Y{ Q#$w;<\2q!o[ ѣm$p{ʦσ.)q\tB2OG@InFWalVƆ[ hhAxȏa5`v ٳ]<`*"'gH[шlqQ b==- I.\d|vpH c[DK>M^|I(q'606ga9r$U3^HO.|.KDK۰0ݓ>smоqlݳtcTcOxG-Vv3'VCQ _4:ʦ8r$ifg='%3䧠F)-&ޤxO^G+ܞ¤ۖڳ* zj&j+gժCajr:}[£5&ܷ.՟PW'5ǩ44k5;=fVr R.^ҩ6OSBq.=ztmK :W)jZ6@ܵy"GRצJ]n9U$w#)zLMP[:g*@Z˃_wG˷ѻ#2G=og>ݓԾj`u}R~9z%;{*u~_>MNrv(607e~1:1َA#}1'dJ%헌4 o\ېlm|{ g:G=3_71Qv'X}nxՐHAfIh{7|K%'i^='m `E$)~׾os3CleGz6< $>f?z&<{ѩ1wz NoCk#gOKx=9wK o/$H~>JznϣO1{ ++@-9̾s\hF2逊w/C{]"G#sߘ |e$M'ē̾>3>S8Fy/O+/q\#?uEcM[??`GwC<FJ޷6?q}/ջTV|7eWqmʫ>.*&JCl>i` 4==O.隕SSbMp}>cLg۾:E",*Ṷ2+GiGB-7 d)~Q$ߔK W^w?:c\%TY||>c=s:y0M޶Rn>9·&ayD*j9P_Ynۄ̚%iBxyFraKo䆯4t>۱O@1$͹? cI,4GYӿT[qFK'|a;5iIf6E~ѴK~52lًraW:4O pHX1PS )2Mj}r5{JXrT4!.E6q^7FDDrP[s;t~g*2di*oΚW-Pku)-?'wc74漊d[)oLME4kqܓ#lq;i-#;+ «Xlˎg-AtIzRgE&ԇ)F)n[-Ķ) Ԧ'oǑjWrYDYq4fT:>䂖t-IZPCFk]"v5NKTcS{1:+ssȠV*uҖԛDqHu MJ26Ϭ[O"dO Y ԫ  #$Qh&ó0~UuTF_l,<>SZaR"n=2lKV^s/St͙^"W_^w]ۣ-̪RvƛJ&T{zXFM^N_y">m-Z9'$8:np[mhv"}BEq\pHZ ݱ~}4WRNs5!S޶e9-7&+ծD.{b W6D62SnIi Rͳm}\maauokK)b'Y -jݻo ̩$ jfCm>,h_W'sSn65́4.VvjNLkjf!TO!Li4f{5% U||ͅtIO)eTF}rbҮ:MJ}uS"Hu)yt-%$]m=au 9jEm;? ngӭܮV,A͐IL_VF4wI:I{DH6@C,YcGhޡd޵epg8̀ƥ6h\\{:-$u[-|D}Lv1mIq.|h#OԳñ%{\l}Ocaw6<-<͜8{^h˪8"z'7/*auS,`!=Y̟5YF'5|*cȐKz@M3tGϒf]ҼD@W1=]tU&x0νʐ nvЙGk[#_g7DoGk}^?Kyw]~w/{HP|᷵X_"F~Ca}M|?n}Ჿ:|Y/miOp3c0Gf[v<^JLD*;υȃp3>2|]㊡%,x[69OXb"oMxGbڽ쉥gVq-7{K_J5h(#^g|LrҮC4z%/{xa_EOģ. Q$]/v=a뫴^qW[=Z˯G˷o!q +fϳPI -xL )sIs}wkrwLX JCkWX܄\^1wH"dd[x>sd2RRL\ xD Hô#.$tc/N%Vm3]( {W+/i? J?ù}ۂ}h9ғn w蚶~3t.xyE^= `(\YkLUtN92Ż@[t%..RpFF||1#k[yKUek3KԻ:l>_J=ph`_MRjhR8yI6+ۉVQ4}K _ge;>vRU# *KY%gVٓJS$OC~3K)$qf(06%J(qdJ8ИT ;Kt؉N:V".1Ǚ$ĕ,ّ ~IdžʤK|iN1c~C^\*QْF"I_6c4%FU^K~u^.1ZnByW5;\ƙ Y7Aԍh]m^xbᗍmNNϹhmSfQٚKi2lm7nZE`jk8J5dYU{"eSlˑPeL[PI7 ncVv*^-ƻ>UyY:Gz^V799>ҪZ[JiKӠ"q2iLZswLh.{W7b=ՙjp0m[u jm÷k #M8?6 0+e92Ɓ{VoC1*jbXc,P&?J_RSʪ'Lncv"c3G/Ym]h*WjYNF22>5$^*ܷyJI4g7j6Jyr2qN2bI{Z:ܽgjEamF[ɷ 1?h KpݷGf=Fĩ381zVg?if^3oEV.dlWe;xY3 2rDW($egMfC[6|0іP楻WZjMd_}Ⱦ-Emrnizn"uJ+jX%ddĒan 6.vzqΗϚ%R:ѭS!TSj#$B*4Ku %*7yhDpN|Ù/+.k~|&\MG*z\IJq ̔]Ĥeϥm)E2/12uZ915ѥW!Sjld&YĦt-)%h>[w~zxϗӜ]S>zTaTӬb#4B*4KuJջI;걢m:[& -ūۋxv1,CsYm3%U>܉p EEEÕ7vֈϽ{\ZfU]# `z3~YWTuyxv൓jd DA]|:< Jgrea;׫,L:nn-4_|IzVzXDnUyOiQ(7i K. oֆ35[V-Ӭv-,5s9+'lzmC L"˝r3kDiE/YzPYkoD^<ս>bۯ.?L1v CyRm*\v׍-0s7Bq>Q ~8/8f,m!V.9qrE;b.:TiۮsTe)Y ZևŒo^Zb֮sdI2mM5ۖR=vvW.?P`ȑBr℄K6A)kKj(NO>-lꮭEK t鉮+Q7{R- Tɖץ)PT=MuЇq>I73}$i(SQ%b;ҁ1Mn<T'TTɵ8DN:E>PiҮ-0MlYD˷&}Fښmȼ ą8DN8ETׅn=hk#뺃lUk*BrM}] :)lAtkI8ɑ-d]udr^2wYhNyV"lozcߝk\o#޹h^uNUlmN/EQ%Hr2&xe?>]`|hM[>kFy,Y?^~|oofcnO]<`mjqg$(tU.( Ս&˓ЛH'݅civ86v896r{.5#R6f2-ٰff> KD `9o@wh)lrltu(4(m]ajmp+y8x~ 7tE<<;8arq912-:2\,֏`|@c,x fwOW| =΍lnq8w\vc(]? ="ٻr/|d8;!(Z\毚\YSx{9~4c}H eg={'%3䧠VQH.z^"y_ G+I /.d|x0%G\0νʐ }ae@D[ =I?t(ݓԾj`u}R~9z%{?keX;:EENk>T{{{x>_>akct1J#x\eL+}$F> r&W%>Nݦ|\|E;VwKdi`g#LȸyIn&H9!.K$ݼ=ٴhԕuO/=&"JH\pRW/t_-D87m.H".".$|7Ieȭ %]R$EuavvHeCr 8 N-d|<\fǶb])4cO-|^Z J'<>#gev"7!{LT6#EX%%aWxJk?+˄̸ dz-/plôvv'eJ-3>S8Fy/O+/q\#?uEcM[??`GwC<òs\6 xUo--ed>qrd3FvƶU:H)-A<SKwV+nl$[p֚&%5~C8WX5j[m¢e}lPe?>]`|hM[>kFy.X83F7Dp߱jA{dF`ޣ~6x\;-2Ɋ.nc7p@lv5fQ)>]zJe#=pAox gF`/wim/$xL/6cgsbLZz[B2?sir{\-^]GDNI "\@1'9|}W63mWBk۫S,`!=Y̟5YF'5|*cȐKz@Mk(:}ĀvG1{$շRZH.z'#~ G?i@W1x0Ss[s@r~+EPO`::K[*@-u~ wG 逎y?pFGˠCѿ]vOkR:^_K 6.Z48{X?E~Io{o'Ʊ+BX2B/.> Gv;*#E-DĄgIóiprqkD2m-mYv x8yĒGvC\#6rgIn$m.eԦdD.^R9 s.!y)7'x;?Η&Fe*.N"=lPV#|˳j뫴~vJxGwgto|EH8v8xC}gtS *ͽcl쑙9!KTbRUmz] 45۠Ӄo|>7KKx[qxH*<]m -Ka>!ּ?k|bd-[|dσ=vO }[Fd_puwk+{?B2dy졏-i.;>D'JOkC߆\h-@)?J_L7Ww> mNx`kz(!HE c*8ѱT q'1{1ލHbwX#}΂\WǾ#>R}^\!GsBX[~)y%@+xSCt\}yސ @7@m? i^\ln?eÜj Gu7LS}!}*{]$z9Cc,x':i<߶>$e9NOG7|b|0G;|~bGi[=9Yi'${+j8x5z9)1PT]"YmzkRrFj-joRYO u[Ӯ[w㜁mbTްZKTD>i ?-VMKV y&zڭc r~GNa~ŷ^ey֨N3iYt j@C,YcGhޡ k_6w4kz$GKvI <`b?%DUZ#o.{`2ӉPfPꄞlAl;*8]:rv%'ͷ+m!p$LTw-OgaatI-Q:] )ZvGGxZ{!G+8}'Dp>-o~^wri{EMWB_~Te,`!=Y̟5YF'5|*x;ղFq5/lT|vBy@#E2/zLy.oJStwtU#p@ZK"@GcPxtWH}}A|gn=rXp{u{Q3VD=!{o`;7 ,iyv;4݄Cdeom-VJ_u۷o/.S}Qn7V}߬FGh. ' ôn{},uxݧfݼipqߜKlW.={eh8>3f Խ+;vWȖApVonp9Gkl|ERPǥmipӸ@}lČlAO~և 3wĸ[Rf.oޮOB|AۜQ9B{O^3=$6TqwcoOFccGwF;<2=|F|$C>|RKW䧠l4 n/@8ҽ~#8os+ޘ~'uqw CsΞo93akQwҷzr̲?xOHQV?Dճ>; qw{3*kks]g qURUKp4h34Z&/MI^ޫE+CfLi µQK5dm*DsQ1%lla+j"cJr3V׷GQjgkt6OF&VV z׷T3[LUuJ ڵR^nLʮu\x/-d[H [bjB^.^{o| 9tVwz/+SMNqJTm@'7]{-9 ^0}MXrV3]la&4zMeҫ[-bd!ɏIml 9$%fͿVTzԉ9b iZvn+vRqZI-qQ2JV`~1㪥eOC,YcGhޡ k_6tiz~$G[ i <`b>>$}x@e$}^ݛ6ڔl".S&;=TESi$H k{x}SŷPc#|/@6$x}D^Qw6 ]r$.kf]Zx+m ?re=2#IF]/Yru\/pE [~ EgtiW.;7j΅U؏u_XCz:j!>j\ϿNjՐTϊt%cMK,%绰߲Oa5=`n?Svv-pw^9)/g|G- )J~g7|.T@ssi_}ΒO>w}w=-uxWd`#|GqqKY{PK{E] "~ @v?gQ;^G@4-/:V-'\]~;#俿O̍7}g !(2x|p ٳad1m\e2sSp "R$H9Iwgk|%E_lm~q/h'} O)A#ͧðidWc%.nCF7 ad\/Yiٴh"sm3L~{F;tedH-3횀~JG$ϼ?|3PԬH˼dGI3g͊3Mat/se]NMҴPoЧ}2/pR TpY7\%n|dgeJw/-bK\]b-Mv'I_t=|}[!v}.G|d[;@-/r%{m|w 6{_daiiil\9{>Hx'JOkC߆\h-@)?J_L7Ww> mNx`kz(!HE c*8ѱT q'1{1ލHbwX#}΂\WǾ#>R}^\!GsBX[~)y%@+xSCt\}yސ @7@m? i^\ln?eÜj Gu7LRJuqw C,\?@~c4y|1;=۽rgH֣=%=?ѥo d~\|~g8|wLgU?PKrV1PkJ˴id zUq_W5Pc٭R%=$4FK3^nKŸ7%R⸢trlҠĖko-m.I&$EHj@sNO7xOz4N, өz"eU5Mێ~M89rJ%*ȲAաk6=OjlYUjږ)QL۴(){&3N@*;TBԾÕ7j#Qjv DvOE)^f"aMZ%PF]I9O ӫZF^ \],bhETnKbQ όm<,ԜV3M!,u1όu4f UoPb4?#5a{Wڿ-OPKa#@2a$ f̀.7А/їN3\]x䧠 Nwet*_\~_\#tx 3@'!ܞG˷s?tc/퓇t"}s=L\7en_ d7Q? tgoC2|d? KK nV{F]v7gR:@^G@:ZmW=W]V>{zRfBaMx LƒDuBvv21h+v2:Lh.:î6mN2D&ZIJb|˿[F5}X_k"XV#39ؓSZW"KBQ.#NޮFF{jItv6ҦZ1uXy*ӕqֻr?ኘ{&57 =Ev=kLogW6[{."{/N vkj$ +4qbɟ U _&/V9;qq`ۄσ<ܹCǺ_TrӧR$~Jk_쥹v>M\_co飘 kq? ?Wc/7?TŊ쭻އɫlwU4o6?]:{GjW?[wWh6?]:{FiTꦵU-;4/HzWg:{G:\xݪ|í|XG km|n"蚶~3t.xyE^= `1bκna5<(ϲUUWmJ}CRYِ 'cNꃍ$N9w9I4C ׫JrMFQ(Z֮,6|ňv:M)Qg5 #l\x2bϗX3ĎH Sn +\]䧠 Nwetj\K.7'sZ^Yty:ڗ9 ˩ډ'pϊw!lj7ˆګu|Ul]F20ZfOWisir?udx`"v6~ fgIvl6,U$]Th}Ie{^ Gp^+n ˪]'p\{\<= ;@;nv;|hq]TC]>.p/fͼ[= Y^s_ ` Q__\'őC>{wF;|D[Ra]"ߊ.݂}^zwc~vu/ToT~i/0zD_-bPmGu˄f[@#$:A;=/fQ{|\*(VE>tTs} 6Up{;mag\'"J/kٰY?_~e Fп @KE;; m$$lvdl0i$ȶs?l%$s/k;2MOkSs(od|phlyvgИ7ER;~k={=i%Ƃ4xu~wz~ L6wΎN?k7zP!2K~@}Z3cG!1wz N#o?j;vLCxIs'9} gmI'OA ri/z@5_7|qz%swG9q-ӧ逊W{_ێ.tg=K`1s|-L>ӽ"|0t>ҷzr̲?xOHSV?Dճ>; qw{3*koEaWN*ŸȵQ,rsUI)pꙑ G+9WJۦgLnT+کʈnnn:HYFd͇܃w&]3}]%2%U6t~p^ؘɷkiozNT a[))vqW$ɵ)zl>fhGˇVSnImש>[|Iʵnώ($ix JSfb&,,uwSkڗ6pmtƔPdUܳaR+a0ߣ+-JS&,h|mi[< maFQL35uIW[f=aιYWvtjP&.Ҹv3j x" NUbb&,/NM>í͡^iiqZq$iADfFGimq2NۭZmh3JдۈuuB\mKCY-&iRF\BDRimm2+K<Ӊ%N ԇq #J̌i M~b"c{mh6l>[i% iNTvaIS-K[VivEؾkm- KZWm)tZڂdM,lj>{dάՐ)tmIZ\.A6Т5%-AVq%~je\1q6rufW?(2qoLQ20NT.uH;>hvD2C1e qy%i%)#3=XzL;N?"C!a[iIJQ$iZa_}a:M6[̐mԣ2""bɓw}"R#ƎϾKli5)J2JRFf{f8UJ"ʘ*SsLOű|BԜkϷOJ*F)džM:8h"(k +b?$AM>6¼m%*zȃRoTj,|2iJ<;6 NvC:e|Jd©Jj-1mDl֢IS^6Fy UjX,Ө3KT1k_7ivV:{xie!G USfYmMB\] Wͬ+Tv.di͢V]`|hM[>kFy/Xn>|OĈ1cx(H5 o2 F`+OK|$=;<[ nΏt|܏x;~I/glȐ[E\=Ƕ?*@Z {=s`6dG--"l@"]{y}v7Gww6 ׏էz(=u5KfvmveĻgh 1GK$x;vqptZy,8 G%u|&..F%| vv89{@*g.dV1-st|ͺG. l^6vz?sa{]S&"|>֫hgggږl>c#DG?>H|[y=\xG{H(RWGhW}@N$-\HSI> -F|o'}#>n鷸?\#{Hߥ'L.4 x٥{Pba'w05Nttbq^yߢHQލ%|Bc>ϭfjG]ރOڎݮ>zFG1 Yl!$ =G9} enxꀸ䧠蹌4 n/@8ҽ~#8ny "W{]"dFX {WxCaLs9F9N/E3~|S8Fv#W+/q\#?u_EcM[??`GwC<޴ͬ ]*RfV 34= ՜[mR)h#&ԅV'o5ՀVt˒uR 2kPכ1bG/GPk*լl!jn㜻 u}x4vE~X3t$PM(' euE]uLk㳠yG(p.kͫոa+7"+tf0i#E6ܥ,i@Ķ7e4n*죤Z@{ î 6j5*\MVB]rVؑgQtU4 yv>W{Vtgb[X2fYywޖeޯݨiuKVN0,䙓* jTf-&49j2$;0v+hm̤C Z;tikæ@j;e>WS5jKZ4>ߏAJ|;%RJL8~pwJho7V5k.Nڝ2ա+5:gkӭj4YXȦKapj") j52,^!4绋J^+Q(_&7>| ߤJ~ 5Gr]Jn2I G$4mn=wi[陇Q:z˷2}bSu*̷#0O=w]3قza!Bn:L2G|֎1*ܓfi)ۮEAU*0]}@*RdEE&\Rpb}qMZcˆ˿\T*I×U玍!U}ɥkRttnt={5eV*ds9]vZN1n'R'a0&I'znM /-Lu@]EC[齫r~s*Mmi)2"UHKwPRM8_sK:'Gf zXFGwK̴kfߵtקZwvCˮѶJUEæ)6TDY:63ajbqۻJ蕕6*=ܨS[l5e%\%=N3Ң"v&wX6?P144'_)ZsXʠHƘ"@S?)8Flr8A商7`t]36Q-j,[vԪR_Pcă6Yqݚt;iQP:.;Qz,7P/BqĚ>n?×Df\*𵓋,Ɵ5lD獿EDju:"51*+Ym"QmdFFC9ȶ6],E%D싺$QK^Ǫ+4I7"ϧCV%*#"T*ZXƏ>1 1UC+־$lH7ϒ] !o2O)#oL?ƘިWrD %A0g͐="Cm6KM!n-(<+IZzH #Tg cbEh7:R\iN8>{TC AmRFʅf2u7Bŕ:i艄\7^UqҮij Xkj$&VsLT2&ksSɸ}/0,\u:.4vlHXoI?<\jcjKyƘt&!拣7ٵ9_Ԛ,[QƎ͍>-ﺄ\je OiJ3\WVJ&8xU`QtxN(-eny^6ۋ"44=ukGzGsRRroEX5\qq{noJ}UtHc2%"W#E"Jq}u=S#=^nVωXB. o(sPyMԈLwB]8{RMz.^<23|QZT+`DiT&+iE4gR"kQ,:jǵlE#5'>n>sahlӖ2 qvGT_0Iuv21y)[p:\[ˣ+IitǛNΣ iܪ.%5KzTɪDϜ$:j\ϿNjՐPllK?Gs+>^ؖvr &Mĵųϱ퀑V؎ϰ<<<`$ #g0+a'/=WxxȻ'@WХ=`.  /a>~alW|~  a`)z|?Sg+Rlkv{<kkҶ|=~ t>FNpy9, #ϲ9L\\Nxܼ{KSڗˇo`_gV5W@n=SZ`=Vn/ݠ3mN֞3j~% -տ6gog"uc[y^M8IKqwQ餢OpRH> >> O|vrpp;Uqd^`. -vf tB؍m0(e[xπ⨜-ͿFZd_[@u(ñ=O@:B"?\A+KϤ-KgH }WI^'kG $g;<, Npvyg<"plWiEt#@X]'I-py=R{Z4AnIW`xaz?u &nrw{CO@bq^yA,^~ bᐨOFc1vIHjG]ރ?4ݮ>zFG1 vԏoo 1BOsގr8?t䧠蹬4 n+_+l`-_Ϋ_Pl9ƮnOPS}޿{]$~ڗc,+j$,tty{l1krrzPlqsK#>Ez9žҷzr̲?xOHWV?Dճ>; qw{3*k:eacDlNzRQ;9VLWEFfӞUN58ԦXPx'[9>P/"ږ-uF_ Mj4XZ\n5b%NGq+ku* M޹b[N4mr6v~1n?PHP_y@TqVWsC\jIbo KuҪΎ5gTYR6Ƽ_@ij{ )׮ ~{OUZ|2ʩ\(w-6i 0Ukϡ &4휨Mwݽl_l+W92x[U0Ķ'`KOy璔Sd𺴳feO` ,b+!o#KH5dZrkXlGBd6{2}kwMn OV,`QMv۷c2EN̴u#Ԛ'ϸҼMj݁B7~kGJf*ⱇmBk8Zoҩ*W1* ʑTppַ j˭H×. b=XUFxʄH-g-ia͑AP%"Cug%Rj?I[N.Cmm6eslZM62ЪzǪ52WuS}[Հ;k.,%+ٶvpn9p)u ϏHfV_ۉW]ᦥnu Si2\$s0΀=~a]Z6͙zfaҡSU.UVzJr+6˧pzئŖ|_c >URre",*oOQQ0RX*6 0q'onՆ&=#ޚ6u-ke:[dj5"6Y"[N&*nLK:i0\$U>jt-Akt,cxȡdԢ۶;t[֕>"2\(>ˬ]&dGFmO8*lwlu?GM=g@nz[f~:[>08N4TR57JLϺԕ#,jT+UFzPe3[-QNhoˈ*F(ur)djGWi* bw=v7AM-Ķ8tS lOڔjΠ"R~hroFN6c?.iTdYٌAnϵv}Tez*mFJe6Ė7oGǎäЬ;umleD/V{6ŏCå3'UH$ N6,an[z~ش5en=Ԏ'ӱ-fGE#ki fDlRs.CY;h< ]jPd`vj6<A97'R_ ^\;i|n*Mclm pV,5 ĭhRjI6#NfM֍#+\l- W]M)%uSXdddFFBSn'MʝA+vHT_^Rɥ漖3h5C+=P}\GH-ѩwf>ԕ;_i3"V%LHvmw#rf 9Y;O,+B|^rmMI(a&7#"22m gˬ|c4bzV5|H&Kѧύ:,o%)C=%}2:exs#i^ښWKhtp;F \-9*֪CQe"H"&%[ R"իu]C hj$ %P6aIK2wj$EKTDKCēJ'&@S5Q$fjT4Kn;[j#ldFFF(BQ7Fm+et=oeó-|4zy1^ .Q8܄HRTDegyZ[mR[h]V_5:$rۖd:x4j4{tڷQk3ޝ2E8< %SKv"w~+U5[~̹ʿ*E[r͉_FovNjub[ӦAF3sB8vmSNM>yT/+2cCu*39 Æ<>~[}5-?2]zҶM9«֭݁{>sd/"wZv-:@k6$RfQM_o,Ֆ|ݧG"Ruկ[wq7N%mIų_nKRuS1HY3W^9ZYfʨY6vܼ.}-XλoTjLF-vZ=γ1fVL]MbrΜ|H]CϧVjǤd4X6=0aQ++t Jʿ2#mZ3M&͢U&::1^q݉5s BƋie]ۧ`ZePkTٟ]hjj(ҮYSؓYb;9SXͻkjhZHbDqGL~>=FJ Nĩڵ13ǣwm|ے;iN?ɕYQiVm`sdIv̺4ݽ]:!~u7 jNDݙ*nZUNɓ&==~ڢUi$ݺ )qf'"nٗRmk)jdɓGўI_vdn8>NEm[vqor[[rL ^b7]^8qt$'i9m+r#8ԤF5y[tNj6kXwf{]B.\#&g:UMq3))(u-go+x|]r-æKKP޻l+d2P5o[-c&܍EZYl0n:ͪncʫRӾGthj??ִ2]?"Hʝ)vֹ;6z%.ԫMjB0n:/S5:vuC׍>ɴ j*L(3jtHdBL MvC7j|wh{uaۇFz˴*VWx lJ-Fku |4ޥF!FȆҪ9W9z3-)_gLz2_&xs WB7Te,`!=Y̟5YF'5|'")k'`bYux6v;`%#b[wLlK\?>_a Io!Dҧl$\%g( I[]m_SW1*{:l"5p]*%kEG.AOT8alz[yKp@HV5#WGn=|^Z =>S^n?ml\%kW:pplҭ@Զ{9}9 \Q!8;}t(Ddg L<>g` KN JilOWdd;ݵLxl]/#>MImO'L-xxO퀣T|N 6O"J'] Ʒ]."cXRsarqsbnxĒs{=pB:5 #uno<<vVڸ'JOkC߆\h-@)?J_L7Ww> mNx`_ܡbq^ym-6T1yDc$t Og֌b})a^wclБ۴|;{d}##x[SLi'~q;%{RtoO0:?\ q%@Z%Üj Au8+ޫ(؇˲F^٫oHHY![vRe[z@c,qIsK#P&h%y.t(q(3D\E;3awQGݴ_@{8J@2O>#gXVp7Q(Ǥ"֕3wE־oXyn,E=Z:WZ25F&32~=J|J3n@@Kv680K KU1 *eꆁh@kjsˤB'R}ZiwKHh:Cv~Yʙ?x5bѼ]Mn4mSrN25 yܙ]C-^u|'N梦߿Vs&;LMzt}}>iWNN1j+ [8!P2ϒ>ĖWQt VŏLtU C1flB`nmZ:ٍ+V,ͺP$}lVQn OY dn3 t;fLxTY-(3 Pqh"hɷ2eOY|Zl_7Sf<ٴ~$kmDCm` ;Dli8_,ifC)!XqQH!(u mJbTWYJZBTFDciQ!nqߊP 6dq1"W֕RddF6i/4+7 m:\IF-pIZOla<*4%!MLKIWKCV%DdF0U8[Jr fYL+]LjT*2PT3T'Kyn[Rfc5=;UbjZlVS'jU*uB:VjvLɳ$u)QFffc=NS]FQ"}B?3sΖK2\}--kQU䫂SWgQ+uzf-cԪzJK*5:Ffޙ>>cuZuũJQ@s(hǺ1ƒ1W̽.Z7˜~|%s"B:92ԪLvwڏ>J9MiD}`~L;;?.#Gײ vT,<[5(~ttlb.:Z;=tzl~wqNCNWE{􉻾ĺ'Ƚ㾮'ܛ>MΩQ/j/"1C1}u)J܅XKe nؽr=.B&b@@a\J3Rfg3-+FذeP)Vlb4U& j48P 2i.Bڥ(X8z´v,: fͲJ\Z5nPil4U6mG]eJ3R΋trFZYɺs{"+um)Zb;ͱWmɊ̧ *Z_읇n*3^kenj^2JսTRLvL-qɒ˛W2mD:ǵUԪ1Av5nj'Q&&;"!N&:KEL?s WRK&F]\1Y2ʿfūYխͧ2 -/=[淮kn8/+j֨c]^GضAuj,jUZLxqefkޕ\evZoT8KTNC->ǚ7±,]dZ[>ðm%fZ(F-rC"b 6O R[LiUeY9{ŠSm[.ʷmQ%*n`1L)ёʹxO3ֵ"ڷF޵Z56޷hTG3Mxm{fbi%qH=(v]h" ٵmlj=J< e2#l$`|*~|:3@*}aZča?|߈cYQҐkp?3WM#\G2;,nxb?-e++$_V~@ߧ:<bE"UrLrR۬„sQԚG$?-l̒owubC-e;#$v_4 bEVrrRی‚k1̚G$Ș6fIt)@*縩5ԷEfD.$pH-4l%lַI%cGz= ؙ3㼷{'S^Sk54*nvv[Vzu9T"!uXN˓9jJS~Pwk[4˃4?|s_}N_]oľ'*cڷ%M4uS=zTTÍ(2yޭ_}VAFr|+ï]vſwtŏjܗ]6`MڭRPb+6N(ˏ= 5%\1n~*e:Me& HT*qТzTO)$hB {7ٿHC(Nۻt܏bUN潬^Eյ v8]zmgAU#bT;hݑ#Ў},}{8b'.<07Ӎs NI߿'>|HYr!1 dt ϖ/ji{l:bg.9ӵփ h[NHΙ VDZˑ-k$HVHuSrzIG7gxwƣDGi1!׽UWԺMS$Ju2dIR$5oƯ{=)anN(ҵiV+:͗lld(Y(IφXpI=2tx $M]rvE|y{e[PqͫLWZX嬷ɵ UU"ېY "hs>t7>b]>]nkۅjezfZVKP%RjM )=U!Ia%\۟FqYyŹJFfsiW)۵hyn%*aduҒ4y7ce?v.:~+)$;;~jFy\̺%Y)߅QO3LS]=n6,SZșgY#طboAog󫖝rֺP:|$;̚5;nn.AY[Yط}^r_Udͭڕb駵E\@E a aMldGiپυ-mIةnBTr3Ue~߁R*z3uXo w8ڣkA~:+ oeӋ9K5`J}/G%c+n5ccʅe\VuKfN[ʅ*Iƌ51`9kS[;fa=֥CK+u,ЭZ-G6(I(tT&b&ST׺6C+cR+[t NuMښ^۩fnZl֪9BL(G뢢32bNp)T"s&~vצšXzÑ,gHNV& ,EOHSn& Dzk^5WiHWKLЌ7|ǣ}[4n_ǿ'nJUь{bZ\ENrϸ>T[Vlў-烫)&fvr8Եܵq4QiM3/=!c!i-k.}UUU1GȖVsly(pI3LĥK?u|,c{f+rMBqZm;y*əߵ˩-zE_ѝ ꩎oE~WLa/H BgG;zpݗU~t.~޺FXR2 U Uj-.}sW.GNWe9&o)|0AlI)k;O[2|=`%=,.\/y#|}}u"G[x8\mL)lh]:ePF6l~Zl/ .#ZDv{ ;tUf޹k]" jųm]&^6ݽ^b\: ^{\`)b4l/0^FJw2*d_.zFK> ,;j\.dgWt]{\<|$j¢Uwsj{nG׏VF=)٭B۬ohoZl@Ե Ե퀐4io9 D[l{86t'v8LO͝3^B\P[vٳ~"=PivlnOGuPxȈO.l>>B>sQ5HD.g"?g s EpFKw@Xg=݌KvGYԯvi?pȀ{MIh{7|K%'i^='m EO1HqE6~0VE>t;e]3T^n/g\~ԏ'ek]C"5O@?YO΍M[P|ܽ}Q#!-x)#v{.+\-!.~Χp ăҏalϴ]&\rp/5lq,~J˧gHjuͿTuqw C,s{[=~ {_(c43K?pP#ܾ}^fq1.$7N~ҷzr̲?xOH_V?Dճ>; qw{3*k5C'Lw~l# eͪSxWc6-RknZJb|6eAIvXK&#F ~4:?[z+{? -`'e?>]`|hM[>kFy0Xv>|o_x1cx(H5+n&.Xco3^mji֝B\mJBҴ-&dddddcC6n2hyi%mĚۈYV̌dJViRIIWU*J*IaD{HHmRummlK<Ӊ48ӭq 2RLaط-yBP)m*Rh4SIY4 6KQ$շaMܷ侊 CD6)S!Mɥ>L2O)qDVݛOg0KdQ!AQc34Y2u$goPKZDnn"b\PB%-ZYTG'8Ii{8Wmqw;t'wEoXvE&" 5&[MS& k(졽.ICr(]^ WTD oh\sX_Y.puH/wQz5զK G`=ji?S^r2oq֩V_>3 9 촹mk%f%F퀵ͤ}Rܵ?OYW-CU\Z~CLT&#m 5j3JLMY eڤ4ȖUSPDzD!K=i*;m! %IJ3=dGIxwW=,[ ַw\T[mB"n"O|)PuthrTa%Ny4 4ʵG^Ϫd%x+[8}LMvnzg mrUq"Si\ BgErsJT9*joW&5{O57M\ɏ9ޙonz.p*]IEu0DiJ%mM+ѴFKu'@ %6MVe ]b(o0ĕNN),B t>#lkK7jI.NlUo ]tAPBUrN)*',tkfFYMLk+KZVmu-iV"ݤURVBGzt>>!mڌR%REAO]ZFVe⪽ԙ6F G66PFDy%b)ԭ pԅmF`HB՛\CMTIanJ:|i#Kh ȔfFEmumCZtMZjKZCf\BpSUd"$"T1FT%%Mm),Ɋ-\S'9W/n6!fߧ]gMNv۬?P .1 u=]bݙ bV.\j-]OQMZvխ"T"M$ǘr9:N()v˂ݚlz\LSɞg3*!>1͵7%g4Tj˧i GQjYW ӊsSTUV՝O Hŵ)< SSl:.s$je6eN!rc>DDbkEhZЮM:E0N%& 鬓mj\9q$[D|R#ONb.+#$=KIyJTIqi1vxۖlYۗMqhc TUmNvó;v21\.&of=<\xI}~ |<#z3cnWo\Ctx4s,4=}5lgu] z@a|ߐ)4]XO5:,;I{\؆9sٱ2=[ͳR* Yd]IY5M+/*j#'c[3{.tibg%h\:=W&{;8[նe[ZɡݗuYʥ,*rF@´zuJk iNs_R31>v{;P\x. .q^UyO\sIQ8{Y+¸y_asݧf~oZn5"2^eȼjyVsr%bYMrQPM @F4R̽E]E*5VbpOGxzt)ӂJ:Rv09#'V@ydy ptvxڷ$y'z!(qqv^5OD\`., $\<\="\$|=\U.I6v; aٳ>|z[8W |[='?oW)Ka\gxi]G\eqOw@ur.M~MM_9@S3QyͼS TEfV%_`-erw\vvyLZ/\' _uZݿ]ڠ'iR=&>:zB-h~y?Sg?@Lplږ{dKم-}wqu' ƬMbٷtm_wL>Nnnz-Ƣ8ә?2KS=S&~6ʿ5iu;鱱͇?liid{ʤZ2n*m;ÊORW%IIӡ[v˖Y2EufD5_>0k!mѲ3GXѳ/AVmJu)z? LXj ʤ5_tiP^b%SQcF$2^FښT?#tszn=Z< KdA#>3^ !wcіj:[r׶ݦdߩ\W!ƥ:2ڑ0Fh}ؔ(wYvFi>3g}M8{'\*J\dU9&W5&i$O!ؔ(3I:'Fɳ0+)+l SEF쪟54߬R}D[S{ &e}默 nЎOQ,ܖ]ѧSWrfencZ*#>p ̺PFmt%(Ѹrp֎+:) `Xr*vX=Xy"LIQ2m USi4)֡jOrLrjT:n>n E~S2 4ۊ[K /n#VZScyEMs[qTˢH.Ō6nmsmM=ZL `V~nmW(o*h; ܦVkr]P!z,W硥vkJn7 XujD-Zu5'<^ӣN"G[,%(7*}/GYiC18]5k»bS2-: ~pUo ^V>ԣ6.Jd kȩMiSVuInJfDZƱ$R]xY޸=dzͮTlʽG QE~dߘ%nRUK )8K]0ГIv}zgc|cM@ʬ{(ݷF ߨuZ_S0onCzc~STKG O$rF\^/MZ) ~ٸ]Q8]ƊwkMBmnr[CSL|gY0l3v.ߕ5V3?0nKz7S5w]wG"%/KmS-&퉴+50߅Q.)>*jum"}"=lKU(vm\fZb<EBN, GejjS7SW챻w&.ZԆۘ锪uBh[~J/ߘ}_5JL{֚]q"(Cx׺umMAfZQ-Aޔ咯H}RfT !y\.3d^en"Zvt˄s*uyU˪TqXֺάBuwB M$N.]e^<,QjW?d\Ȗv΃4U췓*}OW72RH76Nmdo99v֙쫌,.(^4~eX $ uZMFSϡ,CͨumgN0m87=3vZvޔMKi^IIR`i5u{Ur!πk-ʯnSQgVv\Ո)7"oY ^ As:]G8xqv{C>Ő^/6"2>pE |Sgcnͣ/?Ac^.4{@1}Y=tptfg!|c32K^˳8 &}OK?xaPJW+/q\#?w?EcM[??`GwC<̓FK:Ŵ. [4S([;8:[C)7>bT+ʚ(KNlɧJN}QvigT~5c]. ]yV+,xmjnb.YYeDrvTmn\٧5v!E"ѷA.Xuv*˖P.ZT)2ZQ) %E3sW՛XG$հ]|eV5r>)ɚ.bA:z12 U[:.|^)L;^uti +@>c7 }ןljV6U_Y_+,,X^bݓHym}Ku@Ѯ^Ub5vhxLU_&v&B{wнEˡt{>ĥCXuyVc肿k]v,XW6'h9C1lXNT)My#5zE=cҍ}́i0q)Zjܵ˶V&koۯ#Vt-Pnՠm--nI1 1UC+־$lH7ג[k0{Hd+n&.xc1t X2P]@JlO`*FrYKO@ 6+!*LԸ] lnOFwU.|GGs9sJ.PM|W 1 gg ^ppq0Wk$-ٳg Hˇ.m~o|q\H=r#>p[!8}ݧ?sӳ] z]p}/oHTj^s[v|< (ڍL%x]<{x82 }}SOUv|sjȖaR=&9zK-h~y?Sg?@LpJ@p to7gn.с/0/?A?Ղu Ϧ f&nҙt%Uh*5/*{4TjW]{mtBƃoo%2o7QLl^Ը2i6U6!imڜ} q[:b{jJu]Ƨ#W)6UF!ʏ1s:f[EvA8[S7_L՝1&,&pPpFjoxTKAյlOYI)8J2pyPӼ7G}YO1Jay;LYVZT..-WUTHiQ:Q7$m?n;9cg%)Tt)XmGGNS%҄$ =G,ݺUv_5ؘ#Y-Hj :Ef.hoQԘUJqQ$Pta\FdnGܒnqAH1@(40aLyFdHA%%qfҵ'fezYW7K9צk:Ta5165ֵD뵺W9!Ph'$H~ʙ(]׎뱓sֳHJMTotP?!%z֦Asf|]6@ԫUw^]jBEbڨ4j䶙LB˚T <㍤O^߁=x ,]Erg9枯b+"&l`EMX +rO͓&;Iѿ=dn֯oVSwd(Vto_݇RXҤ1@Jz9y݌[m->6W!rpf|]Sw`lJ87 meu"w%B/b̓@5׈R#֩5 QPo$kκd*gkH)KEF ꜊L\O.VL[Kqq٣ѐ,h̸v9t@v a#߹uHg`.:YuS88y?PrR{K\~ؽ4ɉ4'b li7s?R3qxiY. SuY_g@,(qkqV|E2FۅǴϗap swʮٳal{}$K#D g\;6~+@,H-!ql!<#jepcgdņkY%g{ =+\s7igڀ[pwi[9Yi'${*ǷtͲ~UaMǴתu3 _q^11-=YT֮g4- Ŗiߔu/3"ڽn !Gmkᅵ4T`ukySI{1&uoYUwVZ2Uv1Ii$Z )Җ wʖ%MsMENxgW[cK9ےndwa1/엧\-bLζ`u=`Td7wbZȷV)XI:s'گ0j֫8t{[ 6^0k/UYIn&HDV)goq[gS:?aF܊ylӫZm.ju_!cz V[vNj7zXM5r=kTyȶVmM?"{NَDz>5Xog zw +5,?="S)ɋ Z5axj vv}FkAY#<J-Jv7l|K֑T6}瞊[)m2A /NzN:8N7JjY=[ `k6M ݰnߓ,﹡O4Y[tC0aZImJUFHamܝ5¡3x.m:KmOQpڰ*#o2IuQ W&,bm=wcg+>Y׭o*-nθQ"<7O: ¹ch.6u .xmIb۸3Q\9ƟOL~,P\wտq[ؿ9Yn?C,YcGhޡ k_6tiz~$G{gEy3]XZM',Nq&M~ސĎb0FӸ$ Snr Tqw37m;W@ CUq/ܞH Sp KG7{T{b\>^Q$!TN|W 1o8H[C0s|fp>_"ެp;_t|188hf>2P, ЫN~);lه 47ʋ_/^|fdo=QR.r7pa/1c@v{=0 DÿNc`lE\nF/_~\:\vVc`l~AѮ\_Uڷa[/1o@m_>7"~r`E۷|@6@ߎXHWgKvXp׼޵? 3g=4YtN}Z]m6MdjFDRGžh g[6 kɹ*SDwiWEjJ-Rm%QȉA\u{5pn~zMuւȒlѷDǣsr?)X6^JI9ZhW+󐥽DiJp5rN*ٚz\- gկ"}=vE:IvdL˪hҏjL_b-TKޡ]g\a)7"[8uuup*qS̨F>2-\7;\e*\aΓSo*2-ƕY=>l< T{Pdb{Bv"b&]C,*ضh?)ϱJQ"¥әz\RYi S)F]egcv61(&5-L{c۬=߳l{viڔ(%H"=ޠç)?:S- 2#RYtIC(zOBGSҩP[qq)Y2Y5(όvc=ePq$,[XĶ,sjЬ*܉*lZفLQȨzCi[έfF(ρM%QL`:×YCӒ~P6{m>u*^yIQūoIZg'lkMXunSˍtwWMWQi%Roϩ*25l1S.#Eԛ8UJ+"MҤQDTυyh3#{y#>f.'ft&sM`LTa;Ckeb-B}YRTdk23Sx2.SjlM1A]P>{zeQnͱhP"4I]Z{'#HqYFY+]&a:lM.PbΩ?_*_W[* >#KڻU Lty)7m>nj, Y4lx۷ϦǣNkf^&")Jk ʡȦK l-4Bz-#F7Ǘ/^w㪅65}tZ:6 LJLV] M6*cM ꤺTVm^oj׭ jؓ-ʽ&RBY"dgEdI%6hI$ 8\{;diSSDTfۗ>=P`%ANtܺD4Ehe26JK[,%Ү&P8 jqXvnpRE:ujco2ot9dZgj𦑴Z5jZ1mjRE6}rNf&̥E[ZPKRq-vlql*eE1:}mҩU Ң"2& lfWD33;- IU}3isWc-JӒ]nRT+(?.T=q-ԥǫ:[.]DuasݟWJ8JmZVäkKJ(4r>)kcDV)\qYfj-(Uh³qծ"ɷ)6*uW˕ˊ]:75XBH4y]e}vݷmha[4*=mFeZ\J->%2, \jl]g[Tf|" 9p"oaga~z-JE^2v㺧RTFC%~zK븥+iޝ=XϿku{۲=4 ʜ lN\ 5{/cM=a (icVu>pݪTdy.ɞmH<'b+vQ6mGT<̫Shs9jjq'!~ m1ho͝q4̗)2uj|0Z&ÒOKo]H5ҿ ,L}Ij w{FL{6K%'i^}n>8m>qq n olQL;<`Vg.4v^7 p= \`}Rb3Hj&x\lY\=>Z=#2aԼ.Wcawvl{HZݩ%c#>q!;F%UJIx*|g÷]Z}Hl#=GUH ol.#L1m-1}*ˋo&khR#Jvq Ɠ=&bUIIWfff]dj$hp8 g}:쪑lؓ$pplPup(xxLwx^ !Dqim2W4@(xvl>>>C8L9~a%أ.U#γrsΉsVo" Ǧ%W2H7ޢv'[V׸X!N*]V:jʒdBtExjw{ǙZ2ټ>^5\Y7JU.ԮWtATFOӟK `$۽5jkOAKyeL5P>olsuV|ŅxS6)N:zVԆ4kW0}_!iT>lmTYA gM`B1FTƗ%E˿*-ܑnKLTEB+^XM]i;]]k iV~:q18˃0Emj\mKîԭ$Ʈ12nꡩl*9<ݧm0fYy*߬5gDe˯JU|=4g]qn.]<匯Mm.ٵLD<z350p7p 9vōES**9k6T{>G&[%7RdK@~@cyVP'cO@?toob_eL gˬ|c4bzV5|H%K ѧϕ9oH5X@2l2NeԊ]?Oy~kFmg6\O<;Jl03<)ͤ‚Sm 7m=o@6_A*v b^/g rT^U"|~ :6@|z@b+;9{ WB?Te,`!=y?6wT^[佟XQݾ͝!z=<-%n"|{<6I[<\;]jU'[98O@;h)=vg }?H{;{j#[Yygfh Km52-qvR]$@7N}@@4.Dp̀4/$G#qmir% {۶9kD^m߹4p"qvl$QR=uFCD$\d[gkn͇NLy3"-f(ģJvlٰ˃nv*z_gtֶz- 5ٳKWrvnfn/ޠ3VZ|67HoG'"K[? o-9KFE  v'<<%@/"WKo`˗\{} al.p ؞]P7ocF݄[O\7U7÷noWg̘[ ;8{@(z2Q>~ ,,3n K_vOgo28pSIqrG{ݤh8ܴ}J/Odj5~0i`<) [CoĘ[$#=vSwsvKqȎ>O\cE#.FY!<$lqD6E@,m?֗ΞQ2glKI52$GZ[ȶmc5bJZlsmJ|d'mZ$Tχipt wDH9xrrj(R͜;vsl7с\"J|>/'gr..quR]<^...l ^sR#'~.\#J>ClgاjY vv6d<>uZ%M"#ٴϻ˴f*hw.#e˴b%Ս|&J="K>2TZ$p^͜DGO`>>E1$I5s f/irtRy{l1=3ݜ;O0~p.m]#?}?EOt: qw{3*kDdsgeyb܇IrbRӻhUk47* W!T&oT)5wEuH7ba+IiоW\*k$F@'eْ.=&y7YjԠ*!P,q孶,4ug\ 7'*6]Z>PV5 {}[Y*ϑ\X^}:oQ"Gu[@h-=ѿ0yU{6q~Kf1M3f\۱KZ4(,gBָ_jK:t>) _U~a7k{n.™&Y-zw-Y#.J#v}]Ƕ6 Qo5WS)]U7yW.k3zl6Mk09$ިhU{.2J̥ܪSR]nҥlW=giжNQdb+YԈ-KӋ:CUQԛ)HR/p_4e2"t6ӶLmmpa+>.%"}F\r%=e$\9/UCO&~q:R9 jl+uCk\MTqh>S_4))FDE2եҫsi7NR\wWqԔ~Uc[~pV筴6;*dtҔjapGr~n&kW\yMK&)uveyuYi EB2L Bd.H,_ko;iͳ2}tK0Pm2d&٤ݴ T-uaO$8j"07剬ͥRȷ8eEm9Rzsfo^/\ȓudiSI Ddvu-^o,KGTYC[tXkŘtKrCz+"!Q˫ uV#V&ՍY6NU>ߵl,[^x[ *cfHRu0ۈf{󦵛rHNbktU>H>๱ ԗMU&1VAEX"+ގmG%1oɫ.Kn*`iA\lz4VԘ S%*˾S(Ȍ5UmJe%ݛv}?Q VjPDڭZ/? P HUv&y0UX4!6-#}FܣQn2N6TuAfHL^>Ȭ4Dvm#N=]G{׬ڛzЪ3U,tF.f4y񎦀LyXֵ#`<,n Sg+"8 rؾ$~dM^K%w0{@2ىTF\G_Pwd_/R]I' [n/jZ.>ޮ@TwҎ{R[8| [=&_P!?KTOQ^jeC?Zg]@{Rw]'!+kot #|:r GoaP>=o~Nx_r<V@2/v]_[ =_ѽu*d84gVu{QvDg=$ 5"qpImK**X] ,tl)1~*&{` lt" 'hko'lE2IĹxpqpp%RHNnZ)I+{a{;6p'I${rZKKiYl]22oI$u%-%݉[G=+viuu/P.3~6@f軷)/1en˷F^nr̶yE·(ȫd-k-ol'j"K|=^_sK"J8[;|;_ "G`Rxy imٳDҪ ry6Ka+*lO{{ݿl|Llr#\`;D^`9TaF~W 4U*.^^> =>^lluj].ݣy\~?tAlY%Fm̸x$eǷiǮWnWȾpvty_nY}3Ϟ|t~Τ䏠gRp7QHQQd;F>fݿb2j+|hI/ȶ4,t$q+QVKC;W~MI]Df,4|H~*ΞEj9p;is[],6Nm"MUGd:m7("kJS#[Y#yI,߶[ ).j项yE,Ta*jA)LMޢMg#cvZfЮ˃~7=qW=z[!|D9K'-/2v{xI3>i؍)g(▚j$)Ҍɮ$;|{\.9rDDOcU5( ͛t,l}!W4lAD".c]4;mb@P xH5C*bGK댪pRn:jd7uN˙lduCg*ES[.,qy[ =C]^٩U)͛tz3qdY Ji.\ljآӸ龭rKB[iUJY}j o6.%iڕSi_UM~b^H9dpRnJlz,F=ys"9qM)D[u 2ؤvhٗMwRrJح+1锩R1qM)DCQy@^\dӨhmLm_r#i$2(fCk6DK3--e~Xj;{5k:6#Ŗ9Yb=YuLd[y 2شتcytTM>j\Z `!#"Bծ$˙hЉM\cp< $L972۳H|hGxQMPqZ^/8,95KR@C{> 0uEVk5¿ƥ17ze?¬Y`ߥ_5 7GjǹsJ nQȈ5Zm41%} D%)5*m7Pߨ[&O*mpaF*SB J!"NXǃi4ȮͩU4ML'ӰU4Hiu!ԡ%f&ފkq Z(UjmX[]y&HCh-J!/r۲wQMSe̴9:S]"Ǻ:kam6rO 6c\)Dd@gMRⰤK$̪[4 FϟXe<=BI3EY=91XoY"@ReE5TfUQM-=N::Xhz!E't\QL5;)7re5u&}iE-&rO#JHC⛝+ZtDjnT.bdO†/DU2:kbC11^qۺy^/ã2jFjmw@r@s@q={}ĖW7G+Wcas{-%ο÷a(<S> S__0'!9<{\G?Z:c.osNcb?;y.+ˮګu|Ul/]?F0[<e;Z/k-^E'ՍkoF\Kh GJ$w?Wس)ZY.NNBɴā V*$mGU \Rm'""qmwwSgɳꀮh"/.N.PKg}۶gDeG/0 Ko/IzOֈruL|;uӈ/3PDg}][o7t@[)%<<÷^wgaA%.Pg[̻_9l۴N .cݨ[55P-.MolфOSz-E,9[g7c@}y`ǷB/f@<]]jC ]۲$!p{@-3Mcg1z$~ R"$p#q'{\%D^wnVŭx{;{{XEx{{##7[#/F}>C'f9LVf8G۷g`7?8f~plx=Eɭدw/>FGvvvxR + wW[U{x6Gn+2Q,ݓ:Ľ 1qM{>> .:=}~NcdV.'{5T}[;DGؽ3ilf-ATeG/R[vlu{yXۜ$ڮmqѰPL+/"0x${~bQmEagc̀W/dKap{xw\HY$D^ƮzGc=]q;8t6۷n?Pvuvŷ>=Wg/:ٗ "2wggdUw o Q(kTׇm w1mkVĮ.3pdkжl==89oD~Z]}vE z{2.s3{'ḯ\E|@!I#I|':ng ނu~ֹ÷o Kٖs6]?]k}>'jg=ftѺ.xz`=# `rvטm\iZR4jE:4ɏK*JDX!U$}[MaebȰu]*ͶR)j…oPr㈅I@f;D(ɶi㏩y]DEQke(0R >nPqOS2Yiw{ yd (K"1`Z5BDzZ &TBκ="?mY$c: E֮.ݤT>U*p"A5m*r%=NrȗmʷNю -BLDɊmDF]IHfI~ X+QiS*X׽|O|>lT!I \Z\n%[:#>񬧌2ԕ[.P5+Hֱkߴe[b)*6VGqis͸uz#:S7+[Yq1_J)U/4ZRFÙI:9D:oI2uqfwJ8̶ ,*JmJм1vTS}Ϧ?21FCu}GP2>2{~c :~Y R[W=9dv<@vL )[}b>% TX jSslMqgHUKshS$Tg'rܦc=tͼV[2/| w 貵?qnj?&T]i-JɠQiN*CFMquG$%x^'Q8vȔ,V^MrURlZ[:(\S75›i[:V]qhl췋ejHq6N%-r(,;tQ.]D/N4wxPQKVso~U':ɩ2Ї#ijαm5X1~+GuSe[ț4T=lLclu=gFw M+`H:\*ɢi8eZ/:{|l9>Hߙ-N5fm)(\D9U Y-kmyvrZðJؓU&2we;Fm]n-EE.c [8=_hOrlhxN俫WQX$Z"mUqt*h6;۔4?6)FT:7Bn覛)؊zծmO-ӯ;r] *i6=XDCdO)FBbźk}JlXڱuTa]N4)c5(W.)NCeƐ%OJQC>+L+Wwzqe+\ zU:ѩY;bد~켒UT-Zdg-(i1~m+R%bmHz31})]4AcʵJYԼp-I/V!bM#PRs#8@m9̴xZ%6I6ڊwNNm Ze*% HdPczGIOˊ\_ȋ‘vz_/'WgyοUίP]ޕo]2R?$,+vUc|w7Sf?z~u&kK㋧||?&~Wzɛ{|]5[[:m)2?+?/>~PAR~ zQU%~ 9>cyΫ^=/aom>L-o*%c|?w/~S鞫|ߟw? :|8'ȦW_|Y4;; V~goYO\szu^L%?#c/~QJ񅃎>PGÿ!ZM>T/Ȍ1y:sSǥ6?{x{>~^hǔkRHzUYW-"1Q} D#";f(mNTm,%IzhNZ+XVT+[¡n@c"V6TS&eMEAQ.e;\K]2c].avOY IUۖ+ 5$B3ZZc$! j,dK,4tO,JmkHN3qVg?Uõ*NRIBhj;DM4Dͧk JZ8(TVl.qVrި֮ љa'TZ)I!I["mfA'4fc*ᯪ#=uת2kWUsȃ$gHm2Y%It Z+5H^듣l6k*kok51m53gFEoƱt'9Brc7Hv˙k۝ہ5+ΫO)SJlt0uYO̹GMj&-}Y-tj\1}Uc}.2cmzKzB>ZZ$SڟћZ2~&&7]s:/,YjzM FS3٫ɘV8ؙ9(jB6QK/7Z^<{0[?j{Ovle:ˁR*Ԓ01T{EϗfZr9Nы)n!ɢ^.YVMb:Qd,Er*]FVU"jFyWpr/􍦋Gh`*/bҬuZLZ̮VbS. e)a-($M0iҞq.̵q-M T~huLyUTn*3CD[vB $RagOgaK=rslAaϟ}VC=yJIa庆țCPD",hKTgxBYT\M^ͯ5f%Wu-ҔҔHX *bϗX3ow+m÷mpscx6 N|#>ͷ;[;}\v8R|<= UAKj.3^ JlWcg.yMlݤ}"j+WxK`"NAkon.co'h wH$H]_*{yb_:?Zݪ2/v]_[ =}?ѹu*|d84gVu{Qvl.~"ŭW~ှ68;{zX6D~ј VΞgc|l:_Ѵ*t&୽S1GzcU$%u-IiAͯt2 2p&K2)l{[i=^IZDdȖUZĔƊi%imJ6ɺ E\VeIe_RkQuRHIHK>Ɉ5ߣ8s~6˹nU.: / n-C:DJzZbCvBYjSq-)FӽKӑ06dc4#16jiLsCVKLwf;)[g\Ee͹ҙFUPZmԪTn% BcM?^uICiR0{ݷmeʍ`Xz3ˊc42W-V%dJd*@T>j̵ik7pϏLѩ~\V,2$=Z)#Q%~_^.nLncYUˢj14:&:&'qi< I% #RSDٮfe Y$-gBY/ayZ18(.;(D9*TqFJHϬJJZqL9¡OvS RjVjWqQRdsjKcGs1Ϙ8ndU4~祒 ܀ݫQbU>q<fI3"^Гp~9XoO׾Hͨ83g9,>1B_nQ[b+ѓv='de.Y2.=-.>>[9{^. -E |@.U:x\{6RIpl/9!$";& !Ϻ2. 2Kg=}.b[v(lwg&ݼ5.W6sDZm#FGNn/oa't;˃iJ]G1~(Y ->ﳋ<8@\H)vo7hT] nMJ ?[{Kol` >FFI].aOle$Aw8s?)g'g# ~A'f>[8udi)Oo>1]+)Im+)Q)Q/W/g6߶d]bd,^\ƾ$`^p߮m]v6 Ipܸvڢm۴tЏg8yϳ!./%Ϻ񾻏gj_CJqpqqm>31u[vO*!_i+/onʶ>y2ܱxQOJG覞6sn?nLgV@5q 5#533=u(kOZ!Zr՞lLeo=wm]";O؁PeiFe:O3 3`MZ}0m_b-Hb[0I8RƸ_/LZhMKV#-R .Bͳl#W5}5n{ɇ,/j\9t+*`UnIZ[oɒkm=zd]F[8G0 -ochZxڸxѭCRZ.:gr[y^j>_mlynn+Z]gU*5yTS{HA {x~ãUpu\8V츨<'ݔ%J\σ)3#"4..oIYZ9Q*¨ȼ0N@rD-OVǤ%@=if[il[gWMI#{?WTt!~7wB]f]PcK ,bRH2z:J~':oqn6U:#Kv\*MuTZjŏ)܄Oβ \piշp}Ցs>*zIQz`;{ 56$tu%)a+hs],EueL5f]w6m*s<{r~UR]U̧G֔:,zriEvi }n6(o=ZC݅]w&Ipc}W"d}]R[) T^819,Єi@p\qݻ]d)drok\HViMjkй'$ҒuKCm-Ck-a;&sNUYe\Q=ꫛMqW*zrqӢDvqi72zsGզ9-b R2mLKR5Q:Ao"͢78 ypοISv 6Ʈ: um֩[I❗ *:YF3>X1 ˛ա-b\ǶEM*O$EG2|Cө/i Ș1aV[%昶_MJLuoM\}ff|= OɬiBñqU:VmcLʶ\s2|0ӮGᒺ~4&ǭ7]Vjsڷ9-HD͉uWfMC3%qu"V i{-nkbƇT15oUI!kOXb=;O֗p^M1)IcKf] iRlO m::~+]m E`HT¤a \5mbL8_NT MNdoYM-yO.ա9O6E䮻vU} j*@mwisG8_[rec\y5)}V?4j;k̛nZJ%N=)}d2厬_Xmf HB)vDn丯 iI2'h 2ş.>f4y񎦀LyXֵ#`<},/F>731e/bZ=fwcQ8}'6}]9eG$7؎]6l_J =^@ě \F[8y8r M%` UlO-.c0|w'%'sl?go` 'o C.N~*SҢr/q*o*;<@,8+gs.Cj{=M#Kvv}@p.~^W'+a{vW=ogqskSxIe֩tSlY\F0@[<e;Z/k-^E]EwȺ|qB|x8M[=#Peg]8ƶKzŅLvɐ.JLj NʧԨ[rB!;ܦZzŴXKb+<̉}`KāF|edKXJAKPj ;%zML#>:J1+MjJ 4g/v0mrF DLLER2.:IZڨQQLT9 f|UKJ1UJhyf VFV}ZL/<:%B\U|qZmGi⧱GJC7yޢ~+{A;['f]6]oRT*MoRUmɉMB JS$6j `HK:oH8djyx$ˏi5;mmڻwta5AUeǤ,~VVo*qj]ip1(mkM$&lI t8gݝFl+S^ˏ*.Qjke޴*5QmS{jL<15+4XOcT8ZVVk)%uvUpRa,Y(;T%[PjIU;w  YYWfؾ2wk 6 Tz7lũMFꧮ!+Dx 䴴<SdޛgUau_RNkNOR%U]^$QrU"59Sܘ|a5JaBCkfԒ 6riFC۩Qx -{3}%Wtfa\inK''fҥ5|땇)j][VW!J}uW`%sn%%u'gk+c:9s׭;"Զw#w5z.\wϩoڴث[\3>kZc{".+:Z-j޷Ԋ-ft7$/k&gOE94t9/ Č֐ 6ӯ}m->1¶]%weuXXò[O൭jUsKvO`-^qJ_Y`޻gV:.֞,o|w*yRRp.>m(U+vfۙ&Lr#8vD$e<oÎ2>6r>mPq c<Uӧlmrx5[k3KLʬҜ5;d&ϛOT[TkX.%*LuڢO #K]bZhV:qlpcNZX> RwMqgIҮ%_Ok6)bMT&W%gs1IUU Un Tm|}WqvgzQKm mj">#2rD/rF m릝ejuQ.yLdQk[h_^eԒ= ˌtx#:m#-]Mjm##ZH;+wWYΕuRXhw\u5T|ӎ4۞rERGaq AKvхoUq6J_/ȨN69r))YuyǤh3" ~.egz+rRe7!'( rlQ~l-Fx#uO?Nm4\m~[N%=gU!G,[:ƣm+:7ݣ$CoT[NL⡔mjeڬz̠HSo.DU=u$'ǷߨVԻ4͛Sn-Q39!=J[la>iB&}E[HAof͆u|MZ;rzdBqq,r\12LM:5>-jͧTu)O<ydά{oRrv⌭(JÔgt'jmʑEßBT)j=QmIJ-ڙuh^6~jY_x;8if,/]ܖӵJ+TURkn4R:2꩕0/(Ӝ%4yv[HYsnWbk:}OZ.E끉-KXk5%l\1)ܦV]U0$eOv9P~6>1&LW 򋯗<ޱsiPmtg3۳^%^ MmW'vE54I#_or%_t.ٙ{*x2P^rIGDfJH\]\N2# o2Ipt@r I<T$dlW0-E<Ttѓhm.I[86z${6;voggez%m/;{II{H{{},GN>>d92zgowgH felmuGop]箋t5Gp{s]aho q/Y^K+?1/c6={$kEͰ[Davf$>.V݀7+E~o#r{|ZBI:m?=`^gRI=5lFTm$v4M6Wd"@)mͦ{Uϧa N~UCꔞal>c3=ީ|޷m3Jwo/}ojd=Lp.>0үW9m21RtŦi"">~ѷݑkeύ c~TJh|ߎu] zK%&fH~d.ҕ.Sɕ*MG~DN NΨԵJQhjz}BX8WMSjx̟QTg TWd̛2Kq\Rqfffgq?;3/kӟŸޮhV`/XmGZ~q/jF& %m1yyJЧD<~Mf󎸸J蚪uL>ˆŻqdߖ hѭZ?.qNk8j7V㋎(VayrҙVϕ7LbޣZF.A1fۇz8PG|=zþ֭՗(9JG´v]cʽ|ݟfaF^?V}\[2n.5g1/@o&~H|ݔնo:5_KR7u6IA2t%P?)~ 'Y{|T_צ\Կ۷M[Z_T`K6DdM(y/%;}u)' ɯ@P:۪V[WCuUI&kףDW1ӇAVߓ,뾍zVD/SOUi_ͯ%LЎ*k^,󺯡Xt#궣:+3Wz1j-^C>}:䗜듞q)RyeڣkFV7󺗣YGN~G7t{I>מr:~R cLk¾S^ ')(el6Ӫ7WOS[$EGYTs17 ve1U^)? ьP2XQW$\J.DLa=JA}zj'Q:b98X-wƤ'Fj&Z^ GY - /֝;Nց{yz-+{ /h01ܗO%Vߖڱ@-zk|v^UBzRV륤\Ə颌}XzdKyT2Zn-r}_Ls]u<Ԁϫ!S:l4a-+ٕ<{byT(ۣnJ*DRʽqUԻz^e>gֵ*]hB:S닫_GE.{ˌzZmkR\c'~7,dVfSpt4unJ%?Z czFzȷ?:cJUqٖn_22\ḭuq8R*զnFN?wj;ب=h[nCN̉L+ )$NSB@ƻ˳,pnl*TW4Jj;ԕKHԞ~,\uioGS՛G[mflGQ m٥Msֶu)V*vrUS) 6K mJSimUYG{בac EArZGSP+rqe㌯<U0jy茄E æӿԪTW gˬ|c4bz? k_W='F31f/xvsD{v@dN1 g`8HrEObY>!mgfs)bx}'uH3y=/6J|"{6>ݦ)' V ]3‘00FB4\Hԥ+\gZ-~)l. a\\P^\J".gڗ6vgS'ٳG d״͏(Ŵae~nOdߢ{wm]'O? |s,ߟP{[n~*.[-_|1%wg@ CQW"[ {ϻnb7C=[MɆq#DѢ̩6aB-eY%]]U+ʼnڈ,.~fVgI\nI8q!QhQ'U<>qD*4N[*[ԫN4BytSm4Zi+q{ &F}TmZ&7{gTOXذXàVvYO5*MQɓ&3OHQ~Nw-,7@ xfodI_.'X*M6Q͉R*աjVnj Y %o>m]\Յ[ٿ]1bNGǵT׬:xVUn* -4ĔڍjyznHTxv%Vq)鰩oA[$EzSIy A+hQpF6mmzs7uCԤ|ۓ'b tbԭHضwpܷLN RSV Ԥc>ziݕzM:3pofhu%e,\Q|bLǭ=!kО3ZJN]h]5zm S!9:Oo4Qb%~.?zlʟGyIHgd%o/G$u-De~%)-'p?KՏB$?k_9wG:?tyj"ɚ|Sq)݉^܌SKoXe"g:- /k˕ oȾC]5U-zZRKG!3Ћcsv9f#jnJ5RXCx#Ypۻ-鼥UKOLrNLGH6MCֵda."$V]ךǚLX6-riJrGKEԎH<]ojkQK.˷Lo 7BIwK5ܿ]rR呫\V0MEӞn{C"Ze>Ij6?,mQԗVyafye)E6g )(\0q@GRy;Ko8z-_SyV2{#KIjMىM9-*iHym̴M?%o0#, .U+YmWխNtT J*.:S$i--lsq; .k|}֥ZrVƝ1S.rX7nDX=2yUIѪ$gVw\}g|?[8э)7`ʿz7]TlXG_ONC&wAJj'O%B:?(G\NmC'= iUOeq;րm+y~;;??>GoS9`׭m^m@'Ƴv|wݡRJl+^i?]cb%I3#쑐cftmD&V7fy"U^*u=ϝA/jzZv pFt j&Axٵ &TJ)ZuԣĔn":]]Oil8Uu8ˉG W[Al3>=VǚN'%>y~[B⮳aȌDڣN> 6~I\{xnӉwS=?ӿ<6eշpx=BPo'vfϗ巐ԐCtZlky^-Bu }A[4\ETR p􁾛ECl_WpoQn+ ڑ7J¢B߫lvϨ?ɧV@}lA5G䡵ܟ\m]sjiZ/\#HHX.߹4|jﭟ>B_?FhܴF{ lBPi&KՐ?S_H|\#@Ы\tF8T+BPiVM;xG jG:\7 lŠ /a]mP~Jݩ2ߏhi! HuxO^mL]s nӁxɿKc"_65EFl5/XDxfmILiٲS#Rb8K[TK_YfFJKg`})~:3uMY2:qPʕUimrzAjAQ{6'a-2;~>IZĚx-.6(V.kR SSMik[{x )̳I5lJ6SW-63L^4mz«TB'pCf@urd僂yJJQܡy:)R.ubJ1֎4ܘgy6OmW.|yg̩;q.k,gT]"U.;C-ŹSӍfq#2ş.>f4y񎦀L}EcۥkFy&Z&Epg/of 0mzki6hn/" a\@$E(mN#UBJ. HDEE}%iY$]~Dq` ~ήqqDH#Ym{vmeUG|}^逺=TYp#E; 8Oxx{r'm-BFJ$\<@-Mp6-{v{~n+3H\;v0$[xHmen9=b_ AS%>me6|cO1JJۗ¢_9""=O:_p׹+)c?Y?"2^%T]<&϶E,_Tʭ(slh bI؆Hό||]$^X+!0&oa[x:续(95;4+GYHMz\dybSuקL|۹?&`,)2U"5WbͯWpУ۷mBWQ+ "4c<%ũG(mQH[n\lЮ|օ)ElٰD{HҖd֮acU˖,zK#)/gD+j-{R淣5RMF "Je1'vCD\Z]>6֖MjIymآ]K[B!+Sfi%3C.R,,lgK}2,Y[ Ia[Ȍy+B>3#S؏:Z2mŘ1Xsd3.eg!Z2CG*ۻiz3nKBɩ)qDFDl.H1Fn*JEZ.SKII)Œ̖6ȋeź >b_8JX )JmW-!ĒܣW եfKTWZRa(̈UK}~Z6R؁2>lў[Dd[zi󅑰tɌ -I]0ՍOn$F*2KN.-%zUwgmrgEl[JT8_Z,J4RKHLz]VNKqipkIG~7_%ƨ4yoì|56r!7Q,>8k3%KAM K|VMQc-fR\X)eH-͉4쥸v..{e{|&jz 4&ރmx#%@ JvT~뱡תHx#Mٽ-ͥx(wmqSn f[T͙ĪuN-]aۉ=#!ӵnfտyZ56U.5: qź盎}w#5(Lu#cP"Ɩ&0ƷT.vN)? WҧIx]y}gZ6M:͉nbj]Z}o[25FjAU(lajG] .!*-cܽeqUL`\FpٗsNTU%f4|XjlS ٥Т7:v,YT*Y4Zvck{Yq-U%&QDNuOaf.r>!YW>Gŗ%15{ֽ괸apuxr.9i lҴ%Eb|]0?Xv;*EC+:NS]J$&si [uRPJHLC0aa abk13UUmcbkR&..%",VTh\z) &E rL'qIBZFHm3ꤶpp{iiF4ӮFMNeiv0veEjM&ufl(mϫn;hrKq6h5uP)Ż_Su;{d]!O,W3rvՆbY壿e}:/odwq;-=4ng{` bi'ݼ;x vBOcoV{vXpEB@ 5`J-2kJjQ$DҡH3-ձ"yftWWZY*Ǐi(XͦO&9)u6*r}F&\CE0֢ Z:GTnI>4Lb^;4 cKAd JiX8 >6ҤUTJ©ᦟ=rlfͷ^eߎz3NVԋ*U:v˽G)0fp.JŧZ[YJjIeˏvYPo)1'֮mJO MI$aswo.ngf+&ʵo fA}"QQ*u^_KZ)ͧra.6>ꏐ޶#XŨ^11.\8qKd'nKuuU?8I/>;6-i'(U1/7dCyM7*B}:5kٴo9U\jC$E'(^ *2 uiB֨P3}݈2Fd{NUظs>wUfQˡ߮0:B_ĸE[IfF̶}kӞ-"]Zr zmێZĻKJ]=9hY8dip2Yڧu=%C1VFP}԰Ii)]bJ[w}jyQ-rm;M6ΝyK~FXT~$tp24u23-D.hȶ,w˺"B>ȨSa95l棴M05-[DGjK1c? dvzk'cȔE2)1 j5o#3"-O ܴz|ņѼێ> d=!4w`j< 7/Բ~^Y5C]_=TL^:cCqFl"32!w);u¿nMQ*0&[Rĥ)ν.Ƣ;%ǫ>+qIK{rVʹݣo9g!䉶-c*W,*y2a MS$Sbٳ9%ڎBZ$]]ԮMTq%MȩnrDhԕ-DDfdD{x %/%0Jf쥖j޽.,{LOW.5"lj\ [ujihlK-4xޓ^9P\U kdulTo*׷Sm곔jnY7-q{%dyx!H+F~5vJƏ.oQnHP+VĮScU#CR3zṲDu ZaW;HDdm-GZBO'7kgd7:Ild\:9 v*1٫al۷.kvK3;}_j|fO)'BbϗX3\_# xݼ&@:ˇxyR;h)Hxy WpĮ^ %RQ(]ubR\x;~і(;67Zحv>.s=%C۩ťճk`]>*ѮÕz?C[b4O;|_~mÛ C@GI#I~ sQ[OJ"- ,ީ;zwӮ[gt(8aʺF1&) TIwEVNOhYxv J5 jQj1 JӧNaڸPI-BSy)2ZqD]2U"fBR- [-jV&Ul?;6SQ7V.N4*ǐ(S.(2m;Mzu#y_9efȷFԢoA6E\T;vE#nf~^wjG5edl.sop۳h&Tvvl-}יgzǚo3g^sg_zvm|g\E?Ѥ[La,үKv-bzZXTyTj#xd 18ʏF #Rib`'ۓ- Q2k)gUgΫV7~Riv!ēіwPZ5I]iI=0imBRpl[ xENҨ=0KRu Yủ JC7 PU:rמKZ۩'8}bLG[M) Η.LĤ+̩պFVE)m7iS7nfk'@SU4hRJ|JlՉ+Ϣ)'es 8qᣯ )&+8HچkK$Ԗ䦠vl6Y>-+zחۦg(@rkV5z*MJƳ4R[ԻjMD! "2m&fzKVu^$Lwi^z͔RIoٵ˙I6RhLe"6zr6D`UO[n\E?;d}蚖Li㋚gLJ9|TcōSM~m'SM5+Qf]m(zkQwn֛IԒJm[nݑ5OL{t圊'hGJc|hf3vN'}[ Ɍ_+ XQ)$`pIL^m 7d+'`?5k[w mM/ҕ*\ZE:%,) '^e o/S㗲Vo;Ծ,-dkܹKW}ɪ Oid-#Š0%pq6<^[I6q߫JKav.|rvx@vM!'*xн|OٴQo 2׳i>')n11鳡ć"2OTmki{T=Qʷ>r%w{L!].܉2cZJK7E%NӥiUEXib,fiifN;NOO)9&R"}Лf)JJͭH=dZS#Mk+NwP_S*fb:\C싧EARU_Rv<:)hQYqHzGƗjDgu:Ⱦ,xW)CKmijؕ.+vS]2.IZ W-2.1!H%gi-%fbK5ESa"Y:i^hqUF6:ZvyF-d-RByYq]TU)wIȕPiumh=SYWiV +B|uqiIE.3ZLeV¤4qDp^uJ hui!]HκF[$)N5ulMRajB 4GE-s1!/RεEݹ@[>ʱ=9dZ%&Vn4tݭm$GQc8^qi;@mݑM3^Zf]z~uSXqFZ UԒё7$GmğUR񻧛A[4iNĕ+RzԪ*7L9&_fJ+7ZJ&9OV\Wz*PoR< Uf$mQl=oę ľ/Fo Υ`LնM\TOK^' mJ%y1 c'Be+Kd#/ O1[0LtCەT !;1wHз[fkN2ACf2Mr |FJzugMZ89>;~>Z"6ܒqX{Obq4*Uc9 hqQQvf}b"ҾהrzHyB˽-*lr)*WؐzNKm8;F] YiL$ɴ˘:-/RDɴl3[6AxE=B?6 _ч~S2|qO?@z~|:3@(bFG~Osf $ oՉ1qvw8x]MPI#Wc۳Ĵni g|<+I'{D[[J>\6x\|[{g"׈x|= JA#8v{ r\gٰk#"\O2y{;OS{?vs0 "ٷ{;{`:YGJxvhU|'cDr ipH+$W\@YKp&݆|-b+nϪ}]gg @,~W\.0"U D{vka^8O3nm>*۴Eq&U?hb?Y?"2^%T]ė22=|ݐR4Ie[y@K+Z%%puS\Bx\ }2Pmpl.2RG/fB $tp}w@vpm>2WFRD_uٳfTr76vs?U2?wg|@mz g2zFG7@:LB.^~tE.FGmyPuk %mwim.=_H*WvvK'<>}w wVJl=|~(x w۳{?Tݜ{u1P?~6@f,ރp9[@=$!1ۚ'❾孿PosŐ~!ǻ:@Gn-^^ pQ%)Il">tW|oŶNJ+:@ѡ/UUB`Q#R=f"LFT-IxEm:u[S/vutYtIhL/k_(ҭTLYh4INՠ7Q(We5D[Of~ >I5.Ŷ*_zo-8bTr5W5D.1Cs%ЄJu?\Џ;-=e[\N$oU=g L3`͜4yw *ĥU-WĘ"3Օ)5ѵ꦳"Wt[zR4kӵ3GQQԻDhWSڡ|&SQ%MdlzdJ uo\m[+_:Oq;*kM=JQI6ylomŸLo4l+xT=*Iy8GonަnfͷHRѪOrΎ)JW3\[ݯr"J,y"HvuR-jj|Wm- ӝm-ee}{p˜W[h*ұN<ׯ˒o ߱5Rr۸E[y٣I#$iuԷ҈Ok\6kIEb3PR^hfDfb xn:xucM3#2"ٰdޟ2O6t]3x&3t׭N\M;rըC=lRI܈qTmTU Ji. Shw27rOsyfJSl tFii2;7ȱ)x#wY7m6O:2;jک!QKj+ie ?4 ŷuYrQXZ7C,0$dpK5q;}ƴm5u7FWA6lT _VCJ"qM%)<8 ,iPe̘߽v3թRԹ.bӫUQ*lw8FS("A1ǢM\ߖNN-,~Zi$C. !R.[C15ՒPD۪mYGz-.hIK.'$ml8ImR *=<ڱ=\*:폗2]&vjPF̕>BZn @.sfq6Ȗw:ժ~lCXn^>I +X*<$EZu6n$3[Sg>CZUG~㯣BTz$X|<-mR_!}@}b{)aݫ ypc gvH!/gW0-oINmR0l.og0 RHA[{g/2SF222@=To#:?ɖ:VMi5tǹl.IoէۧJ:nռ.Km/8J,Hk|x7g;5y/;u8Fӎm2)|95u[$NږuZȨSdSQz}_U:n'2U'I#{`yF (n-u ]M#xW*m˂٤n@wY6kmP GS!؋Ŷ7w9%ҫu('J=оrrYӉKˈj[BHσn?g$o:dEfUӥ͑LjU>W:hQE1KP`u8rd5:i+M۵|݋(WZGdO((=d|&}WJQiJsԥw~oj/ z8u^ϸ51_r]R0uf,˂ܝ\JrܕuyֱTҩCCҪnAuC6uztKnx:"Wpmך].^w65oluf)~fJkI&i:^wnZ>LO,1ʤcExLS1_{v }^ُq"+IRn>Cl3"t2S\%ô{EmLLQwgH ]Zpjf{8{GvK32_j|fO)'B8Z2KVSҨh*jBCQ SiK>tԆcC2J32"*JFT+iiT)U*FsŅOaSf̒xc4Z$̈tT3*UQdN:[(DR_uImmKZdW)5JrESj锺lgfT*徤1(\ZBMFdD<Ծ]"e}j;nOkY֕M1Yj]^bmUtB$I~Vp%P߽Ln9QCEv™2ؤ&٪¢[kռrbO0I}SbIάTy+i8|"s 7J9}u"ٸUF%*}vbԼZE2s$U*9'Ց%MO)Qڗ1~WeMX!7a_ڣϳe:߬]֖$絠Ԫщ2PH'z=E2NoDW)wjo;q)z]KS5ٸni*IвNR2>){[ndX*9[|˲nm6IRzU˖ZNfMeSUہDy|)IlRz./MTmi3$_r~|ߴ bZphi2)5r չ!JOWb+5n,\/]&FzxQ H*udS7:L˫RK÷QfV]fh+PiVIR&eg[SPiL[xֿqFo8IB6t%cXƏ>1 1?xXoFy\H'eVx@a<$f͜<m쀾K >ȋ\PKJv] fOiN$EonWZH`+HYm\_-E("Y[@n|Gtmeog̀4*ApTaAҕ|O`bL`C7.4I?.m\<:Y72Ug>^>`=W'+'[e÷ZҲ'm^!sݤJGt,JVJj>=}GMۤUXn:ʧE@zJlO9~lj̷W{?`'Thó*V\}Ғ#vHϷ>u%OHlFeɳfe퀨vx\riwf"g>΀Wv@Uri".wo(rn4p8\};rB :KI'7gt@s &'I~~|{4%˗O!mvu2;fGr_go((SrF^aJ".>^sBUo48wfݼ&^"> ZtY([v9@Zj}/ȗo[nݞ϶tnW[Rnvmkw: =}y ?og_S{>@#+2z8{# Sd^$g욞EǴMm_.0HM/>žk#{[~Mlÿ>~W>:NWg >~q~ho6:o_)>|T_ zW y^~SuvrW-(́iwOai{JsdTىKfK/GM͈f:mVNmm(w}H ?/g)9u̷9t YѤEE5KEJJ՗UָNUgøf3VQ4i,Rf>Ҥp4-)/mFcwW7=[L[L_f,]V&yƢZ\ fۇQ*>ߥ3FE^.JE%Lui\b\x̳2;M 6aM-7Cm6Rl!8ѣB8DE؍3 #aXeP%)""-UΕO)JQ,f{Lĉ,cƒ ;1!BqD,X Ǐ% """" /C|~|oG ~D;y~ ?||$}`81Rhii*[J[Ay )"#qR|jRτm2meS2BdiA$][W֣Q33WnDZD[T|I"JKdI". #G5c6Sl4P$;.[CiJMR[+[Rfff:֊ R!Ç_^hJ9g,O8psStpE~$fR'NUSPΈY8Ҝ)YZq$m.3sFKm۱HQ[  p*Z=]zL^SkzWղ]eNDSN4DF\#v#Gj$4# FMFKLHm5ȈOh}. :lRcq#KSK1ZJY)-f|f7tj[Zf-d[LiݦRX1tjt M2"TdH B[Lx[j;)[)FIIF|f9 /C4oG8mk-m(AUGtҔ|w ("{Oai7MZht|m ϩ(BtDn:652I U̕myG-DdE{n,ƏS 2yRd-!~BІƄyHm)5+jEF*txP͛rcjT4^!m< Kq#)0ΩĦSԪ~k*xQPtm4y+\ls)RiO[n% QҡUcjJ|H'3}]uJlP##|7ꀤOi{x6zݩR >F#Wڟ=x а eoV{Vhԗ̇CIuVe - Jq=eҢ24Ǯ;k֥V-3Հ/?jKr@+r֓J[Ԫ%Iiq]^QhcTTĘ7vHLnh(7&STlp*$T餗ibOhؖAbǦ\Y:--3.M &P޸إ&K$0!u-ǝʟGSMjN:2يq#-ں8D:m5M*ْIkwd;3a]nSYO#]v%jC=^q4 SLUӛnfBmi&מ&n-3d{f]U칪NW+9yX-4ƏhP_DI:;q&c-_txkGRcM>% wjV~Xeaç^s+h>I1h`%\ڥtXNDY*ȝxU/u`na~j2DdDH"s Peivx2t5lpf-]j[̫kJVk2j5 I>;q&c-_7VvhOzѢێfJSP/KzV/:cDTEm#q'Ti5+hΎ;YKJAs)֨P2UvG-0)w}s -'i5[hnMPigxi 6ϯU)\Rn]TȒJ^~>e,jm 5[h􃻏Xt~hNZQb[N{kہ-z+#!Pid%eS(ճQRNk"^2į$MB5/2=–d쓒ۖSr2+W_j_$Kp\NÛ?voܻF_7]/pXefڳht+l=lW'՟~d72aS HZj2o vR1l[~=fo"8mєY}QRx W=gXK8N7Th%Uc漣:ZϺW=G&|SmJW[ԙx>37O']j MSXT}Ls\ef;_E+UE s~mMs9CY-w.y7W1hx?X?q???&~mMsmϏ.ٿ5s }MSXWC\?ta{rq7_<"mba^~NsҷUq3_.۞>p|+#%N;;tQmZ զU)4Bh-jԩG*3ֵdHZε$UXzE5y]XJYi|/S&P}sW[ilpR']/psxg.ї|93h>˴esno 2977rÛ?voRݼcVi Csڗķҵ"e5! m0$xLna9jQh2>9Wӯ¥Mͳ1O 4 2.̧5u%V>E,F*4PMQvuu} gg|+ qk "cٺ[rqܳ?Z PF_pʾ¹CfW-oZz QuG, 'cٺ=;-٥`yWW1hx?Xi=֙4nY5s (:Wp˿?¹CfBXq7u0ʾ|+˴esno 2977rwv^0.mz4t q铩ugLJ561ymC]sF|I>*{L{nm'pl1gKuD.,f@!}Hp";υs(7[Z jH^>}P\?taJL֬h _Hu'++ocٺ%.F6_ \Di{?U4>37Ojak~#ԧʿ?¹CfJl֬i?}U4>37Oǖl-Ipʿ?¹CfY~!ԟ& ?} Qof@4ԑ{{vEn ?} EO-Y-s G5"|'/cٺS7Ud:|k9BZК5lǐBLհFv7=^VZC4Jv.6k6K"3#>W4}^_'֖MuHŠY6k2#=C7 = ]/psxg.ї|93h>˴esno 2977rÛ?voܻF_7!V_6ƒA .U͘ǥ2(fFڙ:r]n>lcO,Y5^uz‹[5YjP4U%L.ś1^X՝^/i3oNY:s{E5NCm<ߛ6Fgl8PdB6g \DeF -^a2E4\_sQof@5ԑ훆 ?} Rdof0jL}M>37Ofa+~!ԟpɾ¹CfY-szyWW1hx?X?Mՙ?р#ԧʿ?¹CfJl֬i?}U4>37Of/i{ 7}W1hx?Xi%FVo [.DRGǫ(|M>37OQdS*F^Ʒ}H7ܢɸS+0Kl@֐fIS$im!js)<3pqUݞM[ɇD(jSi3Hi鬒;ۚ%'(y_XE\9.~m2sFN2R&[A$&dfGVkSh"~fԤfCr=/iG`¢+v.]%v)- >nm6N(4;̇ӺVwvI72՛ͲjUJjIEv}:lgԟ1UR+<\7M )m)I#Q{C)>ӥb`@Z'j:X5ܳ2UZ͠Sȗ[TT\9S}NImhѣ^GG.+3fMвŶb7k'.KRtxpYkLwbe=GMmŸk9P{*ÏCߪ/)*%=Zb!S1fW{!Ie4AZΟtnXQZ3N\WaX֓i,Ymu7 2.w8ͭ=.zNJоeꂫAg,UYxVn3P!P1 Irڏ^4ۨ©Sp]q#=D?4oCUᘱtiX毃˓ާyX[RnsmωQBS}d%kZKK5yiZ͓&Xɶ64nZ6EKXY^ʎtA"E ˊ.4R.9?@Ե.+dc|S]Ӧ&sDbggH)S&Z/^BSt5Bq>$Ϧ;G[̡OFȖ_Jc6ٸBrRԞBSZүS&e8TAJÃ,7ݱfmS;.ޯdjj"8/u8]Sw^4hӮ U\t i4Zv7^goA$&DuՓzX-e9Zt&I-~usez:Przm9W :D"p)Ԇ I-wΗ.|5k~5d\6[i=Bݶ4;jDDe\:䦙~R~ϻ[F;;Xչl .(kFt[}BOR1s&bދL:0kUY,څݔ&4E.~؏FvJ P m6u]sdޕsJxӱk$3r.t4nLl(Vĉ)D]`:̂S,- D-M)*aAiZY=>MZEvj3jmA˴jS2S)s ˎ>fCվT}#fb n M۳dT鐟8B6>:b%4RҡOU׵3\6UuK"N4N)OOڿȤUE5ȠNeؒ2#-ԛnq7+ocŹaW(uglTBUbOrշqu* ]QuZ4l m&lqlz-ZϺ/m<'*:FoQyPz𯪋aGV}6r-YZ:l%ʒrm2sjj;Q&E[mb;K72uV䈌cVl9n5NȊ!4ta2Ƹu4 A e싖Ӎs[њt=uV'ÓOᶹ0!HiR,oe־zCM8/3TtsN֥3frjc7IPc2g;Lr<\KڎdJ0Uo+o$—RzI5>zr+ϣ֨6xH&bn"TnE# "f(8z3(5UD7Σic'dƑ8LCCʥk5w*TT ںmD`Ѫ4KI=a~s%-z\u`E]C_¾.ɅYIȵgkj鰗*KeɴͩFD_#ncնkf< r/Œx[”!K챽Z\Z4Q:#Z͚w'eAleJ J2tʔru.{Kj;1*DU ^7%KY_&ꫦ>ZVN4SU#LrɊL"TQgx_,4n0lUh^:YUE22oV'"<86Rb8z#y5 De(c]gy R+a'!d ͗Z-l]MD.U]U%ztp +TfM͓?P4EUܹڸd_X ٶ9"iPLH ٨@"rAJ5jLhR(iȷ-zcEBimZu]%2M*V5ʞ*wv+ VFȹ1`ZxR-i$Ю+Wz"9r z) еK;5IBn}7Ny*".mr*"f̊rhP*&ux d&~.<ὫQmrPKM6*o[rʹΏX~_\"r6$ZY樵HTFz4,3}/Vtk_۸"_T'㋛dWjf%mPˁtyQϏ,=AV7czM߃ov.=":i͹n3wL1̪Zu+7iɡ^n50FulL~$ޑүv&-dj<K6սm2ʕj͸S) ֈg TÒrx𪦎]c&3uGy1t*N2O]Q )TzfNȔ~}g%uW[ШiMXF.s1E&MM2'e", ;XKowD޽&0> kk*[%7+uJθAU5H4D`UXFav(ٯzAݵFn-3r,sol|e96 M!Vj.Xi)7gB͛o W(wgttEHj|,SAȔ|J @F/abIRhTz]ӼԝeFl˦T{nFk$)IZK̲JyP wz ɧtC׊h֕[ԲBHf2`dtu:%뷑XDhjT3WJro8ۣ* SjcȤ.yTr.DDUdQJٍ\jD;lIyi+`&Q1"k%t\K2ХiO/'=ZEEmG [S "F|fVdAf|^u]nN~}ŷ-1&$Ȥ. G8f7|[L_vmO֪u-'52Ji: -qgVI(Saq/Qޭ/=pػ0v9ĶXwW_ksmHUGhœDGa%fedglXI&Ӟ%lAz:ĕ<·o Sib IG qj.Yr61flEzՉjl+YTȬ>ERe}/yOeOKv19"7È,(YC%R^~а7[JST79 梸niNK7a;zg,w2u리=J߷saO꼹.MVae>z˜fC%ȊNK^pu5|^hv-<+[u2NxY}t5Nj(o9NM)*eچ #zY9kYiq뢷r}Btsk^yشɲ\5 Z4 &:KiS(a4oXFq*^O긦Q-UO:xKVb"hfiK}d2gTn٧߯pwJ%F+N[슅އHL7=50aS v%J[)U8}CuMY*F\ƴQ\LOg עҥ<îWI-7j'ޜ#∆tj:419ٗ w3dW=㕺"CmDŽj'OD27VqT.N]=M|T7nUaqխ+MPL# h1WthȆJ/RMci,8 PMJ}D2Z6-0Ԛ-[̵ 6q"aFj+9cJh1z!mQYQ% ;D┟EgO ]5>YH+j՜I>ok)̲Cl9 :]ZѱZjnm;[NM'Me߹ju*G=lz1Ya/DbҘtԅF΍WUx&xiN7ECjci UMzޥV.W$))v+1ˆhV̶5 ">Y@/\wiRkU#fӯă6=-S5QhgmfiRҭkZe(z2"i]|ܬv鮪.:)kQs/Cb uJB%!{0Ii}$ 7= Ҷtс.ڶ Ѥj/R.IEsSNrXoQU&ң׫o*[Gn2NQhg8Ox潖rvl55Q҄N[tʽUӛU0 (SȏhEMS` QՎ݄wUVw&^D7-!UKfEQh松/VѰ&. ̖Y:݋~\ٸ*dH=܌eXu=E>,ND9 SL-hwӵ9g {rza̫fޗ-Li/.>q#˪O'.;ֲNS7"KnM=…lHҔK #%2ДHznrDޛغvZ5թ0$\_(nv> 6FE:c%22 6d=[uG?2:Xf 696EN Ík)a-éʶ*L?SE**ZA^={S5e^T$Lk4K],EZ.TXsQ|]!X"2ZIrZ<[pb'Qzq~vOT%V)!M[wR@XgUI`fq}̇NRޛ-)s*1*W*SeԹ-DuVL)xܕ,; g~OĚS窮' R=jY8NmW0N2aʋ&+0R%FT]~b;P&bӇI;≳UTM{|=fV8}Z8q Lid?!41VXjIyK]2JU@OM]qDa<_zho9Ss6@aJa9VQbJGAˡV,C[Iru TIQ7:%In/+Ҳkp&40(j ~ܦUV5iA.,'-( pK]*ݕzj30۵+!4:16,Rnc ~@+tUSViP3N&4J=iJ#lӛf>޵oFlv9ՊmxWU}S٨HĬl%OZa]#-ٚ[ǹU 1QevD0hwz랙-mS%Bb\I֔z{-ME=mҩ7NrӖ"N겛+3+oB5T*lR:2pRNo:igwmm2x-f*R[y ݇.Z)'Y2U ͵+< Ux (`W2n 2:>d*enuQ9D.qdzy҆q!5MbG3֚0qv̍Vqe,[n_lUӈkIijx";}n ly[q̭ks͚5Im9I"L([Kleۮ8;ݚzƑnщruaZLf2޻Oj.H|!Jz"PӆXڹ޵ 5\.mjCr\|~V5RԤn&+ybCyqJv:Pۆ^|^[i>12|_<,"6.5ru{ELRSir] zD$6Ng7woҎ:>2UZ}+΢]VƾV#Ň]b Sm[1Su`kM61*m~\6iJYו1tvbƔv$֛hyVd_H}m eӪ8SVQi:ٹU DrsM1 '#Jm e-ss_yfqmiSo?Mp<ʽ~JWD_ciz AL|[1[_ *'X݋si?#jc%\3cK%م~Mʵαif#DG$y84&BYAgu^%4ScEenB5XҎԳiƔk5æF(ieD#Cd^v;.̶#J/ݵInU;oJq Yŀ -˵i%(H2Mzo2ZDvUJ4!?ꄘJ>n DIsDuGtܩMGU3SiB([=.U6۫k]5IRTB_<hk!d@gYw5;)޴)mkRTUQxTjuGUBѺK0.'s&apVв Gv7ʶ-W[yUNMsM:9u|Ǭ3ēE/o)hNgS^xR6Ad( K%~ʶkm-U_ZVzaȄ[1^'PMn+͕ʑ=w-U(:㓫]գ4!k7#(Uz*jU_>WJ&+9:Jd-s*Y#4k5m&)rƥ*㮛j}U/ٴO,K\VyYjN>RfTO,OWڃ\l.\|z`Ѫ]LdIq5uf fS锽{1=өfyf,RtMfIrԓSRS%eH%_kHCv}JQ:ųP2uhçr723dRL)rURI^^v!o'ޙJyƨS2,E: 2EwQS uG}ݜ)~u'~ hkB\U =vZMQʦnzJ>ן,mc S#&Or}\ݒWK+"zZQu1%'V+s>GY&hB nv_GToWLyW|\opfVLЄ)!w6,_ծ(1U!4W6S6_+$7Rtzѣ'btۣP[۷0uk)TjUqW2AZY!||"skuvlVίvV Tq6S MWPެ+"mmDLY֪&Yyz6(t;yHZϧv5j{EIM2UʼۖMedu7UW .Sfl٢p3SzO~t\&nº\{|èQiHFw>qZZfiArSm1r94 ؔ=e^t4Vi.|냵3QVl^ϒyRu^o-i/$T$0:g[~G7*ޙ(T 3WtmͥH9 *iUlE-r:R΢\ϣlBwx\wu=]K_t*iSR%+mŰ>VCz9FeeMyF4#A̋NȔ_ZȑTR{{Qt WmbAuCSdp@4CJUNE͔8i#l-,z{ Si bHSjr؁MS`0 N5qZSmԣ"#1èT R`NgCR*U*a@̝:d$8S⒆ГRltr5qSF~l_j,8Pⴷ˗%񣲅-JFfdD85J2L֫Uz5ZTL)ܗ>Q-b ++uZ[mdDfeNMqỦan[Jk$UfrG\ď1LLEGFfAj<`0P$[5ӒF\*; #1)M6rY-ʎu$ 82J )ٞa>ܥ2Ҥ5 AVÒm/8r+JZHȔmi{ THŎѣʉjmRĚGfAj<-$.)Df#h=ʫ^~灾IƆF2r|OHEB_zP+K|,O;;X t̉Jdzt ~* Rnc6jع V D^S$&2(he5{𧻓\9onzY­d{r.݊D˜dn&$ Xu[RM)FlD0W&$c=,/E9ة4WaЛ)ߔ i Li&Mmd d< |wo8ppe{s/Om& C+:3$&2(i.9[e"RoƔm2\1K!ĚYÖҶe ;`{J*.Q"U^KɜT>f$nJ׈S]tክ}Sٛ 2=JTsFqf{L^m; ʘ\T,`yFV*[/(bQZIu)+Fqj>%_E6 nNXki; /Y y)57e-ȕYg#uO256Z~h3*6uQuL4[8A}"4<58RJ\4{n7ѿ mHvXpm6ܒ5&ગv-[HԥS5)TjCcq1`oV5hJk1:Q/&{HJOkQD4 J'5Ntunf wַ/8VjZoߙVw/hWw'H+s,X ~>Yy_ձJqͩ;T=FU>TKmuCLI%oSas6#ꋿ>D]7*ir^*=OCUU&u^jQ+X1|d#/n.:]Sme;Q1\p-He%W<6jLmL%7Q2_cxM,c#V76E޻]aWەJI'cIe64-$dF=JkiflXDԦ[%>Vȅ:3o2.nI#/":t'nU8K"Ǟ d=1 TCk.e;րB6͵vjP*VJ3o N=_V]B^(Y7Iwd1jzAhYVž*Kv>"JɲiG.cv:emre-i,S0UK>/ Vf6̘E`ىzVb E WOWv,7"F0U2>d*ɭ%tR G媥|S\rubW3뺴uf fqpfVLЄw#2]F'u,6ŊN5۩Ք^.Zj`Jv䬩yuN゙J'Xjf]n18tnFFv,*I%=NWI+^PnrD-)T8 fEU\\FH܎#6aQRH/;:/ΤAhU3t늷!?ybo֤#9:=tI#W`Wt߆u\&r 5Yv%k =qt{.>ڤ> R#gi8MR4iQkgsASrn׼UZ׽BJ+4©]ZQn$7j=i;ȼs"0;(?ݑo]w#)LjST()MVK_R3F;渥#~ɺ-N beMK>KdXJ%Bz-yts.1VzCkjc|]ZZgT_\pRM+JjJi-z@/1Hu4]u)uk!+7f>uJ=nQerLwH*ƚZuF}ƙնۏCӎ$ZH}qibrnm~UB)§M0)t@␇$(..IEo[5[/tec+2SWFqlD[ xi)!>45`m:Kajh-"RoLs0Nl;ck@= 6]bL3:t(Gɚk u>llh*:rn{z{YS7]]cs%mδjfRϪA ,yKw5wcڹbF1_d,]T\L&Tj\(<׫č%.usugγsv4ypd\z\qϗOԍ:_BQBƗ&j_ζlսo,W2m:9Ě[QiV2M~ȼjfW!ٶs&Srh+eO7 TTf\Y+%|WiƍHOcI/GU\jm[[$.&,xkiN7ISS$H9#]wNgXzy2.̼hK 2*iǞ! :;1TڜDrY#^$vrj6]a'(tIGQ:2/ZUmlז\DJ4#S[u.5:uQnK0ڸj\vèW*͵Lv _z4sӮ7jKUEzgOZџ(R>&+ggګ]u[n9Fy؊Ӓ!% QwKl/Iʵ!P{M1WzR;t#tgѩjXYf;j{5ZM*nj"&T/ C"/Zkl!1>ݧLKg12;#)mTiNάUi'GvT9S۬Irm0Nm%ݯIasP:rwZ͵l㝩J=neǑW*%^2}]ԧT]jQ~AE))^-^Ntok{L7%m\5vJ;QuwSRal+qڦD;tx PvTN]xn֖C>]Qr.|MWkqw#R"ϵWZ>/Us $GIXKW.20=#R_T#]k >B9HWc6yM"~iIPҦѻu=B5ݥ89E#ܕNfT*zןi\>'LjWOeS7r&ѣ+RYV[N'\Ys|RfgGU. 5V$Vn[Q)2aR??fNsU5,S٪mVWtQ(́2xVgLrz[aQ$^="dm:[9(їLi%ơKjNvubNQ:;ʞfKgSm%Iusoq.|ߢKSú׎mgOjQtK.ۮ[R 76ku .n;b7EbKMTi,$IV.Cy m8uW1!dLfW9{r)T .a昍9'*Y/W7Pʐ!!ǎlF{.^^=M?ʫvEtZW++9PJٸM\;2jS^M6lA]SN8M ܛ0<ʵ?O8GJRٳX^UJTB %r$T%P&H9Sn-fGj]s_¸B -4m(6[mTvDE+kWy\(r_-ո-k=wۿO4t6thؗfg_p\>7r^WtVnzyK\5I&:UF)p Gt;K[vl|UwVZ,D]9Tm&#3 Gzrqo+ESι4yN.=Oir[Ci̜Bu&>R0dJðy wx&rA:}՞PyMUjůԣQ d&T˵[Hp'KezDVS~yT7R3xރiV٬M ]Ώ/VT5JTMrʛO5+'IZoޛ)Z4ĚFm=ܷme>pW("MRHbRj#씩OX3=fx+׮07JLD d{(W)˽+b(@>F٦i暌E&K]P[XX:Ðt`+Q>&뿨TŊpLAAp܁ u}#vY7il=w*Ӗ6d.|1d T'&)Rc^SԊS,}-N08<9f{}yQwfjP}k?.qإ]Pgo myVE;k S+:lk4]},jCz 1KOQ9ֻ[千si3j>fW J4癪3zU(5[-m>g}~#nfoܸʣίAmRTT.7wSu:XMMHAkwޮa-3RmdjQ6ek/qդV\ tWd+b%~Kf_KUV ꠵m4*)+XJvq(UavKGsַP\7MKF-Zyf{%g=?RVHue+/beƢ\GQ"0iwf*j&DGKADYt?JXj:о1UV ˗7-*wUT7ba.ƧLzeu LF[)@#2cZ3?P4UuڕG.{*ϥo*N:vYVԙ*3%Êv{,fnd`qi+4fmZuJ))j#6=ԩ1c^q-.u򝩉jǧz3XjVݽu4R[ttg_ɍ?4V5q|ji+]zSa,^cYtTR)zpd;ƷcږSd,͙+{t3n7μ7vV.Vʚ(3iNS*fE:rkoH4T1!q^yi3PyaY]TZY3E)[v7Z1~2-rVSdݬ1.1)%T jXP}|T>A$íojy1՘Bn6YdTtQ" 5>kB̤a<֝>uRqVQ؜6WHNU&Gi/> W/IklV(RSMvDX9 [ {7}6͉Jy3۔kc}yoۃㄾ.9纻zY'`.ӵbYs2PºAN#d꟞r-?E>4kP]Qr.|MWkqw#R"ϵWZ>/Us $B9XKW.20=#R_T#]k >B9HWc6yM"~iRT4tn]kOwƐwikx%NFzT܉4hԖxճӺgԨYYUnKfU"u6uUg; L}iGm;,w@G,>٣SnK-vjUU&EJ+ L5p^"D^Cb}OHNc9te#S9vGqRڨӭ杝XӭNrY9Iq`\K_7uj;Szˏ"sTK%9 d7=_Oz PRu_.` 5XsCTYA2E_?qZoQuޫ[[Nd$}n:0ϗ>1Fl-_\naZoG:d']- sA)fI:z> Zѵpկ evKƑUWYh\s)}^ J2#HIz,ǧ0Xu^XvAUY6_rupןAKN׋z{u^u%ғ+2dԗ0=xc=fѝW^CVշ &pb™RUFzC]9H/'=2cО4˦¥UyE_6$B\Uy.Tҝ̳"69D!kݸJX˹upYMAWmtVX9=4b`?8&l ?ŷS^].y:-n͝X^Gx:ҷn+q叏Ts48UӘQϗ{S}" xf\9rùs1]c7(OTZoM9RLPu+@K5)eIēϮMAԥJX~\?^|UI;;S6~U6ǭPŷYMO~4ʨ8yHRϒ`z7RukkJhOn[}ԘW1fʈve}Niޫ@..eڤX֞-bLTjmMē*ԥ%^ 5d_vvEpSccywЯjX7mUw d Tg6'Q'3e5SE $WyV[]GlШP몪Я{f&ȘۍZLA(YҽݩkXn)0PMUͥi\Zb5uTi]͖-[%IiF\[rNsŃL_6%>r*mLOMFQ=X:8c Dk]$'8